Fare clic su Fraud Monitoring
Seleziona Pagina

Dolore cronico

Dolore cronico: Ognuno sente dolore ogni tanto. Tagliare il dito o tirare un muscolo, il dolore è il modo in cui il tuo corpo ti dice che c'è qualcosa che non va. La ferita guarisce, smetti di farti male.

Il dolore cronico funziona diversamente. Il corpo continua a ferire settimane, mesi o persino anni dopo l'infortunio. I medici definiscono il dolore cronico come qualsiasi dolore che dura da 3 a 6 mesi o più. Il dolore cronico può influenzare la vita quotidiana e la salute mentale. Il dolore viene da una serie di messaggi che attraversano il sistema nervoso. Quando viene ferito, la ferita accende i sensori del dolore in quella zona. Mandano un messaggio sotto forma di un segnale elettrico, che viaggia dal nervo al nervo fino a raggiungere il cervello. Il cervello elabora il segnale e invia il messaggio che il corpo è ferito.

In circostanze normali il segnale si arresta quando viene risolta la causa del dolore, il corpo ripara la ferita sul dito o un muscolo lacerato. Ma con il dolore cronico, i segnali nervosi continuano a sparare anche dopo che la ferita è guarita.

Le condizioni che causano dolore cronico possono iniziare senza una causa evidente. Ma per molti, inizia dopo una ferita o a causa di una condizione di salute. Alcune delle principali cause:

Artrite

Problemi alla schiena

Fibromialgia, una condizione in cui le persone sentono dolore muscolare in tutto il corpo

infezioni

Emicrania e altri mal di testa

Danno al nervo

Infortuni o interventi chirurgici

Sintomi

Il dolore può variare da lieve a grave e può continuare giorno dopo giorno o andare e venire. Può sembrare:

Un dolore sordo

Ardente

Tiro

indolenzimento

spremitura

Rigidezza

Pungente

Pulsazione

Per le risposte a tutte le domande potete rivolgervi al dottor Jimenez 915-850-0900


Un approccio funzionale ai test integrativi

Un approccio funzionale ai test integrativi

Cyrex Laboratories è un laboratorio clinico avanzato specializzato nell'approccio funzionale nell'autoimmunità indotta dall'ambiente. Cyrex lavora con i principali esperti della ricerca medica e fornisce array che affrontano le connessioni incrociate in tutti i sistemi del corpo. In aggiunta a questo, Cyrex si impegna a fornire la migliore qualità per i pazienti migliorando e utilizzando sempre la tecnologia più accurata e avanzata.

Array

Cyrex ha più array che usano per testare i pazienti a seconda dei loro sintomi. Queste matrici vanno da Alzheimer a screening di reattività autoimmune articolari. Spesso, i pazienti che hanno problemi alle articolazioni o al mal di testa e al dolore, possono essere ricondotti a un problema di fondo. Quando un paziente viene da un medico, il professionista valuterà e valuterà il paziente in base ai sintomi che portano. Da qui, il medico può andare su Cyrex e ordinare gli array che soddisfano al meglio le esigenze del proprio paziente. Il sistema Cyrex ruota attorno alla funzione immunitaria e misura gli identificatori che possono influenzare più tessuti del corpo, inclusi cervello, cuore, pancreas, sistema nervoso, fegato, sistema gastrointestinale, ossa e articolazioni. Il tempo di inversione per questi laboratori è abbastanza rapido e aiuta a evidenziare il percorso sottostante dei sintomi del paziente.

Screenshot (54) .png

Le matrici Cyrex usano il siero (un prelievo di sangue) come principale forma di test. Indipendentemente dalla matrice ordinata dal medico, il paziente riceverà lo stesso kit. Il modulo di richiesta che si trova all'interno del kit è ciò che conta per il flebotomista e il laboratorio poiché è qui che verrà contrassegnato l'array ordinato.

Il kit è una piccola scatola con l'etichetta Cyrex Laboratories, Kit per la raccolta del siero. In cima al kit tenuto in posizione da un elastico ci sarà un'etichetta di spedizione e un sacchetto per il campione da inserire una volta raccolti. All'interno del kit è presente una scatola di polistirolo più piccola che include un tubo separatore di siero, un tubo di trasporto del siero, etichette per tubi, un sacchetto a rischio biologico e istruzioni per la raccolta.

Come si può vedere dalla foto sopra, i diversi array testano diverse reazioni / condizioni. Un medico può ordinare uno o più array a seconda del paziente.

L'array 2 è uno dei più popolari, poiché l'intestino che perde è una condizione che colpisce la maggior parte degli americani. Questo test consente di selezionare IgG, IgA e IgM di lipopolisaccaridi e Occludin / Zonulin.

Test integrativi

Spesso, i professionisti useranno più aziende di laboratorio su un paziente. Ciò non è perché uno è superiore all'altro, ma piuttosto perché sono specializzati in diverse aree. Anche se il medico può ordinare laboratori da diverse aziende, è nel miglior interesse del paziente perché consente al professionista di visualizzare più aree per comprendere veramente il problema di base.

I pazienti che presentano sintomi come dolori articolari, mal di testa, difficoltà ad addormentarsi, difficoltà a dormire, intestino permeabile e nebbia cerebrale trarranno sicuramente beneficio dall'utilizzo di più aziende di laboratorio.

Utilizzando l'array Cyrex 2 e DUTCH + CAR il paziente otterrà informazioni estremamente accurate su ciò che sta accadendo nel suo corpo. Il test dell'array Cyrex mostrerà al medico se il paziente ha un intestino che perde e quanto è grave. Mentre DUTCH + CAR consente al medico di determinare i modelli di cortisolo nel corpo dell'individuo. A volte, questi livelli non si alzano e si abbassano nei momenti giusti, causando stanchezza del paziente o difficoltà a dormire.

La salute del paziente dovrebbe sempre venire al primo posto e quando i medici sono abbastanza informati da utilizzare più di un laboratorio, i benefici per il paziente sono eccezionali. Usando le aziende insieme, il medico è in grado di controllare più aree, senza lasciare congetture quando si tratta di un protocollo di trattamento. Tuttavia, è importante ricordare che i laboratori variano in base alle esigenze del paziente. Alcuni pazienti sono in grado di utilizzare la stessa azienda per tutti i laboratori e ottenere i risultati precisi di cui hanno bisogno.

Cyrex esegue il test per molte condizioni e ha più array. Sebbene molti

I laboratori Cyrex sono un ottimo strumento da usare per professionisti e allenatori della salute! Usando queste matrici, aiuta il medico non solo a trattare i sintomi, ma consente loro di comprendere meglio il problema alla fonte del percorso. Gli strumenti forniti da Cyrex fanno molto per valutare i disturbi complessi che il corpo umano potrebbe avere. Usando Cyrex e accoppiandolo con altri test di DUTCH o labrix, il paziente è in grado di ottenere un trattamento adeguato e tornare agli hobby che amava e si divertiva. Queste aziende sono tutte fantastiche e offrono specialità in diverse aree. Utilizzando più di una società, il patè ottiene davvero i migliori risultati e i medici sono in grado di costruire un solido protocollo di trattamento con tutte le informazioni ottenute. - Kenna Vaughn, Senior Health Coach

* Tutte le informazioni sono state ottenute da Cyrex.com

Lo scopo delle nostre informazioni è limitato a problemi di chiropratica, salute muscoloscheletrica e nervosa, nonché articoli, argomenti e discussioni di medicina funzionale. Utilizziamo protocolli sanitari funzionali per il trattamento di lesioni o disturbi cronici del sistema muscolo-scheletrico. Per discutere ulteriormente l'argomento sopra, non esitate a chiedere al Dr. Alex Jimenez o contattarci al 915-850-0900.

Sollievo dal dolore cronico con il trattamento chiropratico | El Paso, in Texas

Sollievo dal dolore cronico con il trattamento chiropratico | El Paso, in Texas

Gli individui che si occupano di dolore cronico parlano dei loro sintomi e di come hanno influito sulla loro salute generale. Dopo aver ricevuto un trattamento chiropratico, i pazienti descrivono come il chiropratico locale Dr. Alex Jimenez li ha aiutati a tornare alle loro vite normali.

La cura chiropratica si concentra sulla diagnosi, il trattamento e la prevenzione di una varietà di problemi di salute, tra cui lesioni personali. I pazienti possono contare su Dr. Jimenez e il suo staff per sollievo dal dolore cronico con trattamento chiropratico.

El Paso Back Clinic

11860 Vista Del Sol Sollievo dal dolore cronico con trattamento chiropratico | El Paso, in Texas

Siamo benedetti a presentarvi La clinica di benessere e ferita Premier di El Paso.

I nostri servizi sono specializzati e focalizzati sugli infortuni e il processo di recupero completo. Le nostre aree di pratica includono Benessere e nutrizione, Dolore cronico, Lesioni personali, Cura incidente auto, infortuni sul lavoro, Ferita alla schiena, basso Dolore alla schiena, Dolore al collo, Emicrania Trattamento, lesioni sportive, Grave Sciatica, Scoliosi, Dischi disegnati a disco, fibromialgia, Dolore cronico, gestione dello stress e lesioni complesse.

Come clinica di riabilitazione chiropratica e centro di medicina integrata di El Paso, ci concentriamo con passione sul trattamento dei pazienti dopo lesioni frustranti e sindromi da dolore cronico. Ci concentriamo sul miglioramento delle tue capacità attraverso programmi di flessibilità, mobilità e agilità su misura per tutte le fasce di età e disabilità.

Vogliamo che tu viva una vita piena di più energia, atteggiamento positivo, sonno migliore, meno dolore, adeguato peso corporeo e istruito su come mantenere questo stile di vita.

Possiamo farti tornare in carreggiata!

11860 Vista Del Sol Sollievo dal dolore cronico con trattamento chiropratico | El Paso, in Texas

Se ti è piaciuto questo video e ti abbiamo aiutato in qualsiasi modo, non esitare a farlo sottoscrivi e raccomandaci.

Consiglio: Dr. Alex Jimenez - RN, DC, MSACP, CCST

Gradi di salute: http://www.healthgrades.com/review/3SDJ4

Pagina clinica di Facebook: https://www.facebook.com/dralexjimene…

Pagina dello sport di Facebook: https://www.facebook.com/pushasrx/

Pagina degli infortuni di Facebook: https://www.facebook.com/elpasochirop…

Facebook Neuropatia Pagina: https://www.facebook.com/ElPasoNeurop…

Yelp: El Paso Rehabilitation Center: http://goo.gl/pwY2n2

Yelp: El Paso Clinical Center: Trattamento: https://goo.gl/r2QPuZ

Testimonianze cliniche: https://www.dralexjimenez.com/categor…

Informazioni: Dr. Alex Jimenez - Chiropratico

Sito clinico: https://www.dralexjimenez.com

Sito lesioni: https://personalinjurydoctorgroup.com

Sito per lesioni sportive: https://chiropracticscientist.com

Back Injury Site: https://www.elpasobackclinic.com

Pinterest: https://www.pinterest.com/dralexjimenez/

Twitter: https://twitter.com/dralexjimenez

Twitter: https://twitter.com/crossfitdoctor

Raccomandare: PUSH-as-Rx ® ™

Centro di riabilitazione: https://www.pushasrx.com

Facebook: https://www.facebook.com/PUSHftinessa…

PUSH-as-Rx: http://www.push4fitness.com/team/

Diabete e dolore cronico

Diabete e dolore cronico

Gli individui con diabete hanno un rischio di 35 per cento di sviluppare dolore al collo e mal di schiena, secondo una recente ricerca. I ricercatori hanno condotto otto studi di ricerca in occasioni separate che hanno rivelato che gli individui con diabete hanno una maggiore probabilità di sviluppare dolore al collo e mal di schiena. Secondo i ricercatori, il dolore cronico è comune nelle persone con diabete.

Approssimativamente il 80 percento della popolazione sperimenterà un certo tipo di dolore alla schiena nel corso della loro vita e quasi la metà di quel numero soffrirà anche di dolore al collo, secondo i ricercatori. Nel frattempo, il diabete è diventato un problema di salute sempre più comune. A proposito di 382 milioni di persone sono state diagnosticate con diabete tipo 2, secondo l'Organizzazione Mondiale della Sanità.

Nonostante le misure di outcome, sembra che ci siano ancora prove insufficienti nello studio per stabilire una connessione causale tra diabete e dolore cronico ", ha dichiarato Manuela Ferreira, Ph.D., autore senior dello studio di ricerca e professore associato presso l'Institute of Bone dell'università e ricerca congiunta. "Le prove richiedono un'ulteriore valutazione di questa istituzione", ha spiegato.

"Il tipo 2 di diabete e mal di schiena cronico hanno entrambi una forte connessione con la mancanza di attività fisica o esercizio fisico e l'obesità. Thus, potrebbe essere necessario uno sviluppo logico dello studio di ricerca per valutare queste misure di esito in ulteriori dettagli ", ha spiegato. "La nostra valutazione aggiunge alla prova che la gestione del peso e l'attività fisica o l'esercizio fisico svolgono ruoli essenziali in salute e benessere."

Lo studio ha inoltre dimostrato che i farmaci e / o i farmaci per il diabete possono anche influenzare il dolore cronico, probabilmente attraverso il suo effetto sui livelli di zucchero nel sangue. Tuttavia, questa connessione richiede ulteriori studi di ricerca. Inoltre, lo studio di ricerca ha sostenuto che gli operatori sanitari dovrebbero prendere in considerazione lo screening per il diabete in pazienti che cercano sollievo dal dolore cronico, come mal di schiena o dolore al collo.

Dr Jimenez White Coat

Il dolore cronico colpisce molte persone con diabete. Il tipo più comune di dolore cronico frequently segnalati dai pazienti con diabete includono dolore al collo, mal di schiena e dolore neuropatico nelle mani e nei piedi. Il dolore cronico può influenzare le attività fisiche quotidiane di un individuo. Secondo i ricercatori, le persone con diabete hanno un rischio più elevato di sviluppare dolore cronico o sintomi dolorosi che persistono per più di sei mesi.

Dr. Alex Jimenez DC, CCST Insight

Questa immagine ha un attributo alt vuoto; il suo nome file è image-3.png

Acquista ora Include spedizione gratuita.png

Lo scopo delle nostre informazioni è limitato alla chiropratica, problemi di salute spinale e articoli di medicina funzionale, argomenti e discussioni. Per discutere ulteriormente l'argomento di cui sopra, non esitate a chiedere al Dr. Alex Jimenez o contattaci a 915-850-0900 .

A cura di Dr. Alex Jimenez

Pulsante Green Call Now H .png

Discussione aggiuntiva sull'argomento: mal di schiena acuto

Mal di schiena è una delle più diffuse cause di disabilità e giornate perse al lavoro in tutto il mondo. Il mal di schiena attribuisce la seconda ragione più comune per le visite mediche, superate solo dalle infezioni delle alte vie respiratorie. Circa il 80 percento della popolazione subirà dolore alla schiena almeno una volta nella vita. La colonna vertebrale è una struttura complessa composta da ossa, articolazioni, legamenti e muscoli, tra gli altri tessuti molli. Lesioni e / o condizioni aggravate, come dischi erniciati, può eventualmente portare a sintomi di mal di schiena. Le lesioni sportive o gli incidenti automobilistici sono spesso la causa più frequente di mal di schiena, tuttavia a volte il più semplice dei movimenti può avere risultati dolorosi. Fortunatamente, le opzioni di trattamento alternative, come la cura chiropratica, possono aiutare ad alleviare il mal di schiena attraverso l'uso di aggiustamenti spinali e manipolazioni manuali, in definitiva migliorando il sollievo dal dolore.

Formule Xymogen - El Paso, TX

XYMOGEN di Le formule professionali esclusive sono disponibili tramite professionisti sanitari selezionati. La vendita e lo sconto su Internet delle formule XYMOGEN sono severamente vietati.

Con orgoglio, Il dottor Alexander Jimenez rende le formule XYMOGEN disponibili solo per i pazienti sotto la nostra cura.

Si prega di chiamare il nostro ufficio in modo da poter assegnare una consulenza medica per l'accesso immediato.

Se sei un paziente di Injury Medical & Chiropractic Clinic, puoi chiedere informazioni su XYMOGEN chiamando 915-850-0900.

xymogen el paso, tx

Per vostra comodità e revisione del XYMOGEN prodotti si prega di rivedere il seguente link. *XYMOGEN-Catalog-Scaricare

* Tutte le politiche XYMOGEN sopra riportate rimangono rigorosamente in vigore.

***

Benefici delle tecniche di auto-cura per TMD e fibromialgia

Benefici delle tecniche di auto-cura per TMD e fibromialgia

Sebbene i dispositivi orali, come le stecche e le protezioni morso, siano i trattamenti più diffusi per il dolore facciale associato a disordini temporomandibolari, o TMD, i pazienti hanno scoperto che questi rimedi sono spesso meno efficaci delle tecniche di auto-cura, come esercizi alla mascella o impacchi caldi , secondo un nuovo studio di ricerca pubblicato da ricercatori della New York University (NYU) College of Dentistry di New York City.

Lo studio di ricerca, pubblicato sulla rivista Clinical Oral Investigations, dimostra che le tecniche di auto-cura dovrebbero essere utilizzate principalmente per aiutare a trattare i disordini temporomandibolari muscolari o la TMD.

La TMD, a volte nota come TMJ dopo l'articolazione temporo-mandibolare, è una raccolta di condizioni dolorose prevalenti che si sviluppano nell'articolazione della mandibola e nei muscoli circostanti. Il disturbo temporomandibolare miofasciale, o mTMD, è una condizione muscolare che colpisce oltre il 10 delle donne. Gli individui con TMD spesso soffrono di altre condizioni di dolore cronico. Studi di ricerca hanno rilevato che 7 rispetto alla percentuale di 18 di persone con TMD presenta anche fibromialgia, una condizione caratterizzata da dolore diffuso.

Trattamenti per TMD e fibromialgia

Dentisti e pazienti utilizzano un assortimento di trattamenti per aiutare a gestire il dolore del viso, come dispositivi orali come stecche e tutori, medicine contro il dolore, compresi farmaci anti-infiammatori non steroidei e metodi di cura personale come esercizi per le mascelle e impacchi caldi.

I dispositivi orali sono un trattamento prevalente di prima linea per la TMD, indipendentemente dalle misure di outcome dello studio di ricerca riguardanti i loro vantaggi, ha dichiarato Vivian Santiago, Ph.D., MPH, ricercatore presso il Dipartimento di Patologia Orale e Maxillofacciale, Radiologia e Medicina a NYU College of Dentistry e autore principale dello studio di ricerca.

"Mentre è stato scoperto che le stecche orali hanno alcuni benefici, devono ancora essere considerate di successo per i pazienti che hanno dolori diffusi durante il trattamento mTMD," lei spiegò.

In questo studio di ricerca, i ricercatori hanno valutato quali rimedi non medicinali le donne con mTMD hanno utilizzato per gestire il loro dolore e come i pazienti di successo percepivano questi rimedi. I ricercatori hanno intervistato un totale di donne 125 tra cui donne 26 che presentavano fibromialgia e mTMD, in modo da scoprire se il trattamento differiva per i pazienti.

I trattamenti più frequenti riportati sono stati i dispositivi orali (utilizzati da 59 per cento dei partecipanti), la terapia fisica (utilizzata da 54 per cento dei partecipanti) e gli esercizi a casa della mascella (utilizzati da 34 per cento dei partecipanti). I trattamenti meno frequenti riportati sono stati l'agopuntura (utilizzata da 20 per cento), la cura chiropratica (utilizzata da 18 per cento), l'iniezione del punto trigger (utilizzata da 14 per cento), lo yoga (utilizzato da 7 per cento) e la meditazione (utilizzata da 6 per cento). I partecipanti hanno usato frequentemente più di un trattamento.

I partecipanti hanno riportato il maggior miglioramento nel loro dolore da ben note tecniche di auto-cura, come esercizi alla mascella, yoga, meditazione, massaggi e impacchi caldi, con una percentuale di 84 che riporta che queste tecniche hanno aiutato a ridurre i sintomi dolorosi. Solo il 64 percento dei partecipanti che hanno utilizzato i dispositivi orali ha riferito di aver contribuito a migliorare il proprio dolore. Circa la percentuale di 11 delle donne che hanno usato dispositivi orali ha dichiarato che queste hanno peggiorato il loro dolore, un'area che merita ulteriori studi di ricerca.

I dispositivi orali non sono riusciti a superare le tecniche di auto-cura nel migliorare il dolore facciale, secondo Karen Raphael, Ph.D., professore presso il Dipartimento di Patologia Orale e Maxillofacciale, Radiologia e Medicina presso il NYU College of Dentistry e coautore dello studio di ricerca.

"Le nostre misure di risultato incoraggiano l'utilizzo di tecniche di auto-cura come prima linea di trattamento per mTMD prima di contemplare interventi più costosi ", ha affermato Raphael.

I ricercatori non hanno trovato differenze sostanziali tra il quantità di rimedi segnalati da donne con e senza fibromialgia. Mentre l'uso di opzioni di trattamento alternative per mTMD è stato segnalato tra le donne con fibromialgia, ulteriori studi di ricerca sono ancora necessari. Il sollievo dal dolore tendeva a essere maggiore attraverso l'uso di tecniche di auto-cura nelle donne with e senza fibromialgia.

"Mentre la fibromialgia viene diagnosticata da un professionista sanitario, come un reumatologo, la TMD viene tipicamente diagnosticata e curata da un dentista", ha affermato Santiago. "Il nostro studio di ricerca dimostra che i dentisti devono chiedere ai pazienti con dolore facciale se hanno anche dolore cronico diffuso perché questo potrebbe fornire ulteriori informazioni per aiutare a pianificare il loro trattamento".

Dr Jimenez White Coat

La fibromialgia è un problema di salute caratterizzato da dolore cronico diffuso accompagnato da affaticamento, sonno, memoria e problemi di umore. La fibromialgia è stata associata a una varietà di altri problemi di salute, come la TMD e / o l'ATM. Gli individui con questo disturbo doloroso possono spesso lottare per impegnarsi nelle loro attività fisiche quotidiane. Come chiropratico qualificato ed esperto, ho aiutato a curare numerosi pazienti con fibromialgia. È importante per i pazienti sapere che non sono soli quando si tratta di curare i loro sintomi dolorosi. La cura chiropratica è un'opzione di trattamento alternativo che può aiutare a trattare una varietà di problemi di salute, tra cui la fibromialgia.

Dr. Alex Jimenez DC, CCST Insight

Questa immagine ha un attributo alt vuoto; il suo nome file è image-3.png

Acquista ora Include spedizione gratuita.png

Lo scopo delle nostre informazioni è limitato alla chiropratica, problemi di salute spinale e articoli di medicina funzionale, argomenti e discussioni. Per discutere ulteriormente l'argomento di cui sopra, non esitate a chiedere al Dr. Alex Jimenez o contattaci a 915-850-0900 .

A cura di Dr. Alex Jimenez

Pulsante Green Call Now H .png

Discussione aggiuntiva sull'argomento: mal di schiena acuto

Mal di schiena è una delle più diffuse cause di disabilità e giornate perse al lavoro in tutto il mondo. Il mal di schiena attribuisce la seconda ragione più comune per le visite mediche, superate solo dalle infezioni delle alte vie respiratorie. Circa il 80 percento della popolazione subirà dolore alla schiena almeno una volta nella vita. La colonna vertebrale è una struttura complessa composta da ossa, articolazioni, legamenti e muscoli, tra gli altri tessuti molli. Lesioni e / o condizioni aggravate, come dischi erniciati, può eventualmente portare a sintomi di mal di schiena. Le lesioni sportive o gli incidenti automobilistici sono spesso la causa più frequente di mal di schiena, tuttavia a volte il più semplice dei movimenti può avere risultati dolorosi. Fortunatamente, le opzioni di trattamento alternative, come la cura chiropratica, possono aiutare ad alleviare il mal di schiena attraverso l'uso di aggiustamenti spinali e manipolazioni manuali, in definitiva migliorando il sollievo dal dolore.

Formule Xymogen - El Paso, TX

XYMOGEN di Le formule professionali esclusive sono disponibili tramite professionisti sanitari selezionati. La vendita e lo sconto su Internet delle formule XYMOGEN sono severamente vietati.

Con orgoglio, Il dottor Alexander Jimenez rende le formule XYMOGEN disponibili solo per i pazienti sotto la nostra cura.

Si prega di chiamare il nostro ufficio in modo da poter assegnare una consulenza medica per l'accesso immediato.

Se sei un paziente di Injury Medical & Chiropractic Clinic, puoi chiedere informazioni su XYMOGEN chiamando 915-850-0900.

xymogen el paso, tx

Per vostra comodità e revisione del XYMOGEN prodotti si prega di rivedere il seguente link. *XYMOGEN-Catalog-Scaricare

* Tutte le politiche XYMOGEN sopra riportate rimangono rigorosamente in vigore.

***

Smetti di mangiare e ferma il dolore cronico

Smetti di mangiare e ferma il dolore cronico

A volte senti che il tuo dolore cronico peggiora dopo aver mangiato certi cibi? In effetti, studi di ricerca hanno dimostrato che mangiare diversi tipi di alimenti può innescare una risposta infiammatoria nel corpo umano. E sappiamo tutti che l'infiammazione può essere una delle cause primarie per le riacutizzazioni del dolore cronico. Prima di discutere degli alimenti che possono causare infiammazione e degli alimenti che possono combattere l'infiammazione, discutiamo di cosa è l'infiammazione e come è possibile misurare l'infiammazione.

Cos'è l'infiammazione?

L'infiammazione è il meccanismo di difesa naturale del sistema immunitario. Funziona proteggendo il corpo umano da lesioni, malattie e infezioni. L'infiammazione aiuta a mantenere la salute e il benessere generale. Le reazioni allergiche possono anche provocare l'infiammazione. Quando sei ferito o hai un'infezione, puoi vedere i sintomi dell'infiammazione: o gonfiori, punti rossi e punti caldi. Tuttavia, l'infiammazione può verificarsi apparentemente senza una causa. Il modo ideale per diagnosticare l'infiammazione è misurare specifici biomarcatori attraverso esami del sangue.

La proteina C-reattiva, o CRP, una sostanza prodotta dal fegato, è uno dei migliori biomarcatori dell'infiammazione. I livelli di CRP aumentano con l'aumentare dell'infiammazione, quindi, puoi conoscere molto su cosa sta accadendo all'interno del tuo corpo osservando i tuoi livelli di CRP. Secondo l'American Heart Association e il Centers for Disease Control and Prevention, una concentrazione di CRP inferiore a 1.0 mg / L suggerisce un basso rischio di problemi cardiaci; tra 1.0 e 3.0 mg / L suggerisce un rischio medio di problemi cardiaci; e oltre 3.0 mg / L suggerisce un alto rischio di problemi cardiaci. Livelli sostanziali di CRP (superiori a 10 mg / L) possono anche suggerire il rischio di sviluppare altri problemi di salute.

Altri biomarker come monociti attivati, citochine, chemochine, varie molecole di adesione, adiponectina, fibrinogeno e alfa amiloide sierica, sono altri biomarcatori che possono essere misurati attraverso esami del sangue per diagnosticare l'infiammazione. Le risposte infiammatorie consistono in attività simpatica, stress ossidativo, attivazione di fattori nucleari kappaB (NF-kB) e produzione di citochine proinfiammatorie.

I globuli bianchi svolgono un ruolo importante nel sistema immunitario del corpo umano. Ogni volta che un batterio o un virus entra nel flusso sanguigno, i globuli bianchi, o leucociti, riconoscono e distruggono gli invasori stranieri. Potresti credere che un numero maggiore di globuli bianchi potrebbe essere utile poiché i globuli bianchi combattono le infezioni, tuttavia, questo potrebbe non essere necessariamente il caso. Un numero maggiore di globuli bianchi potrebbe indicare la presenza di un altro problema di salute, sebbene un numero elevato di globuli bianchi non sia un problema in sé.

Alimenti che causano l'infiammazione

Non sorprendentemente, gli stessi tipi di alimenti che possono causare infiammazioni sono generalmente considerati dannosi per la nostra salute, come i carboidrati raffinati, le bibite, la carne rossa e le carni lavorate. L'infiammazione è un importante meccanismo di base che è stato associato ad un aumentato rischio di malattie croniche come il diabete di tipo 2 e le malattie cardiache, tra gli altri problemi di salute.

Gli alimenti non salutari contribuiscono anche all'aumento di peso, che è di per sé un fattore di rischio per l'infiammazione. In diversi studi di ricerca, anche dopo che i ricercatori hanno preso in considerazione l'obesità, la connessione tra l'infiammazione e questi alimenti è rimasta, il che suggerisce che l'aumento di peso non è una causa di infiammazione. Alcuni alimenti hanno un maggiore effetto sull'infiammazione e un maggiore consumo calorico.

Gli alimenti che possono causare infiammazione includono:

  • Carboidrati raffinati, come pane bianco e pasticcini
  • Patatine fritte e altri cibi fritti
  • Bibite e altre bevande zuccherate
  • Carne rossa come hamburger e bistecche e carne lavorata come hot dog e salsiccia
  • Margarina, accorciamento e lardo

Alimenti che combattono contro l'infiammazione

In alternativa, ci sono alimenti che combattono contro l'infiammazione e, con essa, la malattia cronica. Alcuni frutti e verdure, come mirtilli, mele e verdure a foglia verde, sono ricchi di polifenoli e antiossidanti, componenti che possono avere effetti anti-infiammatori. Studi di ricerca hanno anche associato noci con biomarcatori ridotti di infiammazione e un ridotto rischio di diabete e malattie cardiovascolari. Anche il caffè può proteggere dall'infiammazione. Scegli cibi anti-infiammatori e potresti migliorare la salute e il benessere generale. Scegli cibi infiammatori e potresti aumentare il rischio di infiammazione e dolore cronico.

Gli alimenti che possono combattere l'infiammazione includono:

  • Pomodori
  • Olio d'oliva
  • Verdure a foglia verde, come spinaci, cavoli e cavoli
  • Noci come mandorle e noci
  • Pesci grassi, come salmone, tonno, sgombro e sardine
  • Frutta come fragole, mirtilli, ciliegie e arance
Dr Jimenez White Coat

Gli operatori sanitari stanno imparando che uno dei modi migliori per ridurre l'infiammazione si trova. non nell'armadietto dei medicinali, ma nel frigorifero. Una dieta anti-infiammatoria può infine aiutare a ridurre la risposta infiammatoria del corpo umano. Il sistema immunitario innesca l'infiammazione per proteggere il corpo umano da lesioni, malattie e infezioni. Ma se l'infiammazione continua, può causare una varietà di problemi di salute, compresi i sintomi del dolore cronico. Studi di ricerca hanno dimostrato che determinati alimenti possono influenzare gli effetti dell'infiammazione nel corpo umano.

Dr. Alex Jimenez DC, CCST Insight

Diete anti-infiammatorie

Per ridurre l'infiammazione, concentrarsi su una dieta generale più sana. Se stai cercando una dieta anti-infiammatoria, considera di seguire la dieta mediterranea, che è ricca di frutta, verdura, noci, cereali integrali, pesce e oli. Il piano dietetico per la longevità, presentato nel libro dal dott. Valter Longo, elimina anche gli alimenti che possono causare infiammazioni, promuovendo il benessere e la longevità. Il digiuno, o restrizione calorica, è noto da tempo per ridurre lo stress ossidativo e rallentare i meccanismi di invecchiamento in vari organismi.

the-longevità-diet-book-new.png

E se il digiuno non fa per te, il piano di longevità del Dr. Valter Longo include anche la dieta mimica a digiuno, o FMD, che ti permette di sperimentare i benefici del digiuno tradizionale senza privare il tuo corpo di cibo. La principale differenza dell'afta epizootica è che invece di eliminare tutto il cibo per diversi giorni o addirittura settimane, si limita l'assunzione di calorie solo per cinque giorni al di fuori del mese. L'afta epizootica può essere praticata una volta al mese per aiutare a promuovere la salute e il benessere generale e per contribuire a ridurre l'infiammazione e il dolore cronico.

Mentre chiunque può seguire l'FMD da solo, il dott. Valter Longo offre il ProLon® digiuno che imita la dieta, un programma alimentare 5-day che è stato confezionato ed etichettato singolarmente per servire gli alimenti necessari per l'afta epizootica in quantità e combinazioni precise. Il programma del pasto consiste in cibi pronti e facili da preparare, a base di piante, tra cui barrette, zuppe, snack, integratori, un concentrato di bevande e tè. Tuttavia, brima iniziando il Il digiuno ProLon® che imita la dieta, programma pasto 5-dayo una delle modifiche allo stile di vita descritte sopra, assicurati di parlare con un medico per scoprire quale trattamento del dolore cronico è giusto per te.

ProLon Fasting Mimicking Diet Banner

Acquista ora Include spedizione gratuita.png

Oltre a ridurre l'infiammazione, una dieta più naturale e meno elaborata può avere effetti notevoli sulla salute fisica ed emotiva. Lo scopo delle nostre informazioni è limitato alla chiropratica, problemi di salute spinale e articoli di medicina funzionale, argomenti e discussioni. Per discutere ulteriormente l'argomento di cui sopra, non esitate a chiedere al Dr. Alex Jimenez o contattaci a 915-850-0900 .

A cura di Dr. Alex Jimenez

Pulsante Green Call Now H .png

Discussione aggiuntiva sull'argomento: mal di schiena acuto

Mal di schiena è una delle più diffuse cause di disabilità e giornate perse al lavoro in tutto il mondo. Il mal di schiena attribuisce la seconda ragione più comune per le visite mediche, superate solo dalle infezioni delle alte vie respiratorie. Circa il 80 percento della popolazione subirà dolore alla schiena almeno una volta nella vita. La colonna vertebrale è una struttura complessa composta da ossa, articolazioni, legamenti e muscoli, tra gli altri tessuti molli. Lesioni e / o condizioni aggravate, come dischi erniciati, può eventualmente portare a sintomi di mal di schiena. Le lesioni sportive o gli incidenti automobilistici sono spesso la causa più frequente di mal di schiena, tuttavia a volte il più semplice dei movimenti può avere risultati dolorosi. Fortunatamente, le opzioni di trattamento alternative, come la cura chiropratica, possono aiutare ad alleviare il mal di schiena attraverso l'uso di aggiustamenti spinali e manipolazioni manuali, in definitiva migliorando il sollievo dal dolore.

Formule Xymogen - El Paso, TX

XYMOGEN di Le formule professionali esclusive sono disponibili tramite professionisti sanitari selezionati. La vendita e lo sconto su Internet delle formule XYMOGEN sono severamente vietati.

Con orgoglio, Il dottor Alexander Jimenez rende le formule XYMOGEN disponibili solo per i pazienti sotto la nostra cura.

Si prega di chiamare il nostro ufficio in modo da poter assegnare una consulenza medica per l'accesso immediato.

Se sei un paziente di Injury Medical & Chiropractic Clinic, puoi chiedere informazioni su XYMOGEN chiamando 915-850-0900.

xymogen el paso, tx

Per vostra comodità e revisione del XYMOGEN prodotti si prega di rivedere il seguente link. *XYMOGEN-Catalog-Scaricare

* Tutte le politiche XYMOGEN sopra riportate rimangono rigorosamente in vigore.

***

Il digiuno e il dolore cronico

Il digiuno e il dolore cronico

Il dolore cronico è un problema di salute comune che colpisce molte persone negli Stati Uniti. Mentre diverse condizioni mediche, come la fibromialgia e la sindrome del dolore miofasciale, possono causare dolore cronico, possono anche svilupparsi a causa di una varietà di altri problemi di salute. Studi di ricerca hanno scoperto che l'infiammazione diffusa è la principale causa di dolore cronico. L'infiammazione è un meccanismo di difesa naturale per lesioni, malattie o infezioni. Ma se il processo infiammatorio continua troppo a lungo, può diventare problematico.

L'infiammazione segnala al sistema immunitario di guarire e riparare i tessuti danneggiati e di proteggersi da batteri e virus. Come accennato in precedenza, tuttavia, l'infiammazione cronica può causare una varietà di problemi di salute, compresi i sintomi del dolore cronico. Modifiche allo stile di vita sano possono aiutare a gestire il dolore cronico, ma prima, capiamo le cause comuni del dolore cronico.

Cos'è l'infiammazione acuta?

L'infiammazione acuta, ad esempio, si verifica in seguito a una ferita o qualcosa di semplice come un mal di gola. È una risposta naturale con effetti avversi, il che significa che funziona localmente nella regione in cui si trova il problema di salute. I segni comuni di infiammazione acuta includono gonfiore, arrossamento, calore, dolore e perdita di funzione, come affermato dalla National Library of Medicine. Quando si sviluppa un'infiammazione acuta, i vasi sanguigni si dilatano causando un aumento del flusso sanguigno e i globuli bianchi nella regione lesa favoriscono il recupero.

Durante l'infiammazione grave, i composti chiamati citochine vengono rilasciati dal tessuto danneggiato. Le citochine agiscono come "segnali di emergenza" che portano sulle cellule immunitarie del corpo umano, così come gli ormoni e numerosi nutrienti per riparare il problema di salute. Inoltre, sostanze simili agli ormoni, note come prostaglandine, causano coaguli di sangue per guarire i tessuti danneggiati, e questi possono anche scatenare febbre e dolore come parte della procedura infiammatoria. Quando il danno o la ferita si riprendono, l'infiammazione si attenua.

Cos'è l'infiammazione cronica?

A differenza delle infiammazioni acute, l'infiammazione cronica ha effetti a lungo termine. L'infiammazione cronica, nota anche come infiammazione persistente, produce bassi livelli di infiammazione in tutto il corpo umano, come dimostrato da un aumento dei marcatori del sistema immunitario situati nel sangue e nei tessuti cellulari. L'infiammazione cronica può anche causare la progressione di varie malattie e condizioni. A volte possono verificarsi livelli elevati di infiammazione anche in assenza di lesioni, malattie o infezioni, che possono anche causare la reazione del sistema immunitario.

Di conseguenza, il sistema immunitario del corpo umano potrebbe iniziare ad attaccare cellule, tessuti o organi sani. I ricercatori stanno ancora cercando di capire le conseguenze dell'infiammazione cronica nel corpo umano e i meccanismi coinvolti in questo processo di difesa naturale. A titolo di esempio, l'infiammazione cronica è stata associata a una varietà di problemi di salute, come le malattie cardiache e l'ictus.

Una teoria suggerisce che quando l'infiammazione rimane nei vasi sanguigni, può favorire l'accumulo di placca. Secondo l'American Heart Association, o l'AHA, se il sistema immunitario identifica la placca come un invasore straniero, i globuli bianchi possono tentare di murare la placca trovata nel sangue che scorre attraverso le arterie. Questo può creare un coagulo di sangue che può bloccare il flusso di sangue al cuore o al cervello, causandone la instabilità e la rottura. Il cancro è un altro problema di salute associato all'infiammazione cronica. Inoltre, secondo il National Cancer Institute, il danno al DNA può anche essere causato da un'infiammazione cronica.

L'infiammazione persistente e di basso grado spesso non ha alcun sintomo, ma gli operatori sanitari possono controllare una proteina C-reattiva, o CRP, nota come acido lipoico, un marker per l'infiammazione presente nel sangue. Elevati livelli di CRP sono associati ad un aumentato rischio di malattie cardiovascolari. Elevati livelli di CRP possono essere trovati in disturbi cronici come il lupus o l'artrite reumatoide.

Nel caso di altre condizioni croniche, come la fibromialgia, il sistema nervoso reagisce in modo eccessivo a una stimolazione specifica, tuttavia, è l'infiammazione che causa sintomi di dolore cronico. Soggettivamente, è quasi impossibile stabilire la differenza tra il dolore cronico causato da un sistema nervoso ipersensibile e il dolore cronico causato da un'infiammazione diffusa. Oltre alla ricerca di indizi nel flusso sanguigno, l'alimentazione di una persona, le abitudini di vita e le esposizioni ambientali possono anche promuovere l'infiammazione cronica.

Dr Jimenez White Coat

L'infiammazione è il meccanismo di difesa naturale del sistema immunitario contro lesioni, malattie o infezioni. Mentre questa risposta infiammatoria può aiutare a guarire e riparare i tessuti, l'infiammazione cronica e diffusa può causare una varietà di problemi di salute, inclusi i sintomi del dolore cronico. Un equilibrato l'alimentazione, compresa una varietà di diete e il digiuno, può aiutare a ridurre l'infiammazione. Il digiuno, noto anche come restrizione calorica, promuove l'apoptosi cellulare e il recupero mitocondriale. Il digiuno che imita la dieta, che fa parte del piano di longevità, è un programma dietetico che "inganna" il corpo umano in uno stato di digiuno per sperimentare i benefici del digiuno tradizionale. Prima di seguire qualsiasi dieta descritta in questo articolo, assicurati di consultare un medico.

Dr. Alex Jimenez DC, CCST Insight

ProLon Fasting Mimicking Diet Banner

Acquista ora Include spedizione gratuita.png

Nutrizione, diete, digiuno e dolore cronico

Le diete antinfiammatorie consistono principalmente nel consumo di frutta e verdura fresca, pesce e grassi. La dieta mediterranea, ad esempio, è una dieta anti-infiammatoria che promuove il consumo moderato di noci, l'ingestione di pochissima carne e il consumo di vino. Le parti anti-infiammatorie degli alimenti, come gli acidi grassi omega-3, proteggono il corpo umano dal damago causato dall'infiammazione.

Una dieta anti-infiammatoria comporta anche l'allontanamento dagli alimenti che potrebbero favorire l'infiammazione. È ideale per ridurre la quantità di alimenti che si mangia, che sono ad alti contenuto di grassi trans e saturi, come le carni. Inoltre, una dieta anti-infiammatoria limita il consumo di carboidrati e cibi raffinati, come pane e riso. Questi promuovono anche il taglio sull'utilizzo di margarina e oli confezionati con acidi grassi omega-6, come girasole, cartamo e oli di mais.

Il digiuno, o restrizione calorica, è noto da tempo per ridurre lo stress ossidativo e rallentare i meccanismi di invecchiamento in vari organismi. Gli effetti del digiuno riguardano la morte cellulare programmata, o apoptosi, trascrizione, efficienza energetica mobile, biogenesi mitocondriale, meccanismi antiossidanti e ritmo circadiano. Il digiuno contribuisce anche all'autofagia mitocondriale, conosciuta come mitofagia, dove i geni dei mitocondri sono stimolati a subire l'apoptosi, che promuove il recupero mitocondriale.

Il digiuno intermittente può aiutarti a combattere l'infiammazione, migliorare la digestione e aumentare la tua longevità. Il corpo umano è progettato per essere in grado di sopravvivere per lunghi periodi di tempo senza cibo. Studi di ricerca hanno dimostrato che il digiuno intermittente può avere cambiamenti positivi nella composizione complessiva del tuo microbiota intestinale. Inoltre, il digiuno intermittente può ridurre la resistenza all'insulina mentre aumenta la risposta del sistema immunitario. Infine, il digiuno intermittente può favorire la produzione di una sostanza, nota come β-idrossibutirrato, che blocca una porzione del sistema immunitario coinvolto nelle malattie infiammatorie e riduce sostanzialmente la produzione di marcatori infiammatori, come le citochine e la proteina C-reattiva o CRP, precedentemente menzionato sopra.

Il piano dietetico per la longevità, presentato nel libro dal dott. Valter Longo, elimina il consumo di alimenti trasformati che possono causare infiammazioni, promuovendo il benessere e la longevità. Questo programma dietetico unico, a differenza della maggior parte delle diete tradizionali, non promuove la perdita di peso. Sebbene tu possa sperimentare la riduzione del peso, l'enfasi di questo programma dietetico unico è sul mangiare sano. È stato dimostrato che il piano dietetico per la longevità aiuta ad attivare il rinnovamento a base di cellule staminali, riduce il grasso addominale e previene la perdita ossea e muscolare legata all'età, oltre a creare resistenza allo sviluppo di malattie cardiovascolari, morbo di Alzheimer, diabete e cancro.

the-longevità-diet-book-new.png

Il digiuno che imita la dieta, o afta epizootica, ti permette di sperimentare i benefici del digiuno tradizionale senza privare il tuo corpo di cibo. La principale differenza dell'afta epizootica è che invece di eliminare completamente tutto il cibo per diversi giorni o anche settimane, si limita l'assunzione di calorie solo per cinque giorni al mese. L'FMD può essere praticato una volta al mese per contribuire a promuovere la salute e il benessere generale.

Mentre chiunque può seguire l'FMD da solo, il ProLon® digiuno che imita la dieta offre un programma pasto 5-day che è stato confezionato singolarmente ed etichettato per ogni giorno, che serve gli alimenti necessari per l'afta epizootica in quantità e combinazioni precise. Il programma pasto è composto da cibi pronti o da preparare, a base di piante, tra cui barrette, zuppe, snack, integratori, un concentrato di bevande e tè. Prima di iniziare il Il digiuno ProLon® che imita la dieta, programma pasto 5-dayo una delle modifiche allo stile di vita descritte sopra, assicurati di parlare con un operatore sanitario per scoprire quale trattamento per il dolore cronico è giusto per te.

Lo scopo delle nostre informazioni è limitato alla chiropratica, problemi di salute spinale e articoli di medicina funzionale, argomenti e discussioni. Per discutere ulteriormente l'argomento di cui sopra, non esitate a chiedere al Dr. Alex Jimenez o contattaci a 915-850-0900 .

A cura di Dr. Alex Jimenez

Pulsante Green Call Now H .png

Discussione aggiuntiva sull'argomento: mal di schiena acuto

Mal di schiena è una delle più diffuse cause di disabilità e giornate perse al lavoro in tutto il mondo. Il mal di schiena attribuisce la seconda ragione più comune per le visite mediche, superate solo dalle infezioni delle alte vie respiratorie. Circa il 80 percento della popolazione subirà dolore alla schiena almeno una volta nella vita. La colonna vertebrale è una struttura complessa composta da ossa, articolazioni, legamenti e muscoli, tra gli altri tessuti molli. Lesioni e / o condizioni aggravate, come dischi erniciati, può eventualmente portare a sintomi di mal di schiena. Le lesioni sportive o gli incidenti automobilistici sono spesso la causa più frequente di mal di schiena, tuttavia a volte il più semplice dei movimenti può avere risultati dolorosi. Fortunatamente, le opzioni di trattamento alternative, come la cura chiropratica, possono aiutare ad alleviare il mal di schiena attraverso l'uso di aggiustamenti spinali e manipolazioni manuali, in definitiva migliorando il sollievo dal dolore.

Formule Xymogen - El Paso, TX

XYMOGEN di Le formule professionali esclusive sono disponibili tramite professionisti sanitari selezionati. La vendita e lo sconto su Internet delle formule XYMOGEN sono severamente vietati.

Con orgoglio, Il dottor Alexander Jimenez rende le formule XYMOGEN disponibili solo per i pazienti sotto la nostra cura.

Si prega di chiamare il nostro ufficio in modo da poter assegnare una consulenza medica per l'accesso immediato.

Se sei un paziente di Injury Medical & Chiropractic Clinic, puoi chiedere informazioni su XYMOGEN chiamando 915-850-0900.

xymogen el paso, tx

Per vostra comodità e revisione del XYMOGEN prodotti si prega di rivedere il seguente link. *XYMOGEN-Catalog-Scaricare

* Tutte le politiche XYMOGEN sopra riportate rimangono rigorosamente in vigore.

***

Depressione e dolore cronico | Video | El Paso, TX.

Depressione e dolore cronico | Video | El Paso, TX.

Il dolore cronico causato da incidenti e / o condizioni aggravate può spesso essere uno dei motivi principali per la depressione nei pazienti. Quando i sintomi dolorosi inducono i pazienti a lottare con il loro quotidiano attività fisiche, la loro salute mentale può essere tremendamente influenzata. La cura chiropratica utilizza aggiustamenti spinali e manipolazioni manuali che potrebbero aiutare a ripristinare l'integrità iniziale della spina dorsale. I pazienti descrivono come la cura chiropratica li abbia aiutati a recuperare il loro benessere e raccomandano vivamente il dott. Alex Jimenez, dottore in chiropratica, come scelta non chirurgica per il dolore cronico e la depressione, uno dei tanti altri problemi di salute comuni.

Rilievo chiropratico

depressione e trattamento del dolore cronico el paso tx.

Siamo benedetti a presentarvi La clinica di benessere e ferita Premier di El Paso.

I nostri servizi sono specializzati e focalizzati sugli infortuni e il processo di recupero completo. Le nostre aree di pratica includono Benessere e nutrizione, Dolore cronico, Lesioni personali, Cura incidente auto, infortuni sul lavoro, Ferita alla schiena, basso Dolore alla schiena, Dolore al collo, Emicrania Trattamento, lesioni sportive, Grave Sciatica, Scoliosi, Dischi disegnati a disco, fibromialgia, Dolore cronico, gestione dello stress e lesioni complesse.

Come clinica di riabilitazione chiropratica e centro di medicina integrata di El Paso, ci concentriamo con passione sul trattamento dei pazienti dopo lesioni frustranti e sindromi da dolore cronico. Ci concentriamo sul miglioramento delle tue capacità attraverso programmi di flessibilità, mobilità e agilità su misura per tutte le fasce di età e disabilità.

Vogliamo che tu viva una vita che si realizza con più energia, atteggiamento positivo, sonno migliore, meno dolore, adeguato peso corporeo ed educato su come mantenere questo stile di vita. Ho fatto una vita di prendersi cura di ognuno dei miei pazienti.

Ti assicuro, accetterò solo il meglio per te ...

Se ti è piaciuto questo video e ti abbiamo aiutato in qualsiasi modo, non esitare a farlo sottoscrivi e raccomandaci.

Consiglio: Dr. Alex Jimenez - Chiropratico

Gradi di salute: http://www.healthgrades.com/review/3SDJ4

Pagina clinica di Facebook: https://www.facebook.com/dralexjimene…

Pagina dello sport di Facebook: https://www.facebook.com/pushasrx/

Pagina degli infortuni di Facebook: https://www.facebook.com/elpasochirop…

Facebook Neuropatia Pagina: https://www.facebook.com/ElPasoNeurop…

Guaire: http://goo.gl/pwY2n2

Testimonianze cliniche: https://www.dralexjimenez.com/categor…

Informazioni: Dr. Alex Jimenez - Chiropratico

Sito clinico: https://www.dralexjimenez.com

Sito lesioni: https://personalinjurydoctorgroup.com

Sito per lesioni sportive: https://chiropracticscientist.com

Back Injury Site: https://www.elpasobackclinic.com

Linked In: https://www.linkedin.com/in/dralexjim…

Pinterest: https://www.pinterest.com/dralexjimenez/

Twitter: https://twitter.com/dralexjimenez

Twitter: https://twitter.com/crossfitdoctor

Raccomandare: PUSH-as-Rx ® ™

Centro di riabilitazione: https://www.pushasrx.com

Facebook: https://www.facebook.com/PUSHftinessa…

PUSH-as-Rx: http://www.push4fitness.com/team/

Riabilitazione del dolore cronico | Video | El Paso, TX.

Riabilitazione del dolore cronico | Video | El Paso, TX.

Dopo un incidente con cadute e cadute, Aracely Norte era limitata nella sua capacità di lavorare, il che ha influito sulla sua qualità di vita. A causa del dolore cronico, Aracely ha avuto difficoltà ad assumersi responsabilità quotidiane regolari. Dopo aver sentito parlare di El Paso, TX. Chiropratico, il dottor Alex Jimenez, del suo avvocato, Aracely trovò sollievo dal suo dolore cronico. Aracely descrive come la dottoressa Jimenez si è presa cura delle sue ferite mentre la educava sui suoi problemi di salute e sul trattamento che le dava. Raccomanda vivamente il dott. Jimenez come scelta non chirurgica per il dolore cronico. Dolore cronico è un problema comune che può verificarsi a causa di una serie di motivi, inclusi infortuni e condizioni di base, tuttavia, cure chiropratiche può aiutare ad eliminare i sintomi del dolore cronico.

Riabilitazione chiropratica

dolore cronico cura chiropratica el paso tx.

Siamo benedetti a presentarvi La clinica di benessere e ferita Premier di El Paso.

I nostri servizi sono specializzati e focalizzati sugli infortuni e il processo di recupero completo. Le nostre aree di pratica includono Benessere e nutrizione, Dolore cronico, Lesioni personali, Cura incidente auto, infortuni sul lavoro, Ferita alla schiena, basso Dolore alla schiena, Dolore al collo, Emicrania Trattamento, lesioni sportive, Grave Sciatica, Scoliosi, Dischi disegnati a disco, fibromialgia, Dolore cronico, gestione dello stress e lesioni complesse.

Come clinica di riabilitazione chiropratica e centro di medicina integrata di El Paso, ci concentriamo con passione sul trattamento dei pazienti dopo lesioni frustranti e sindromi da dolore cronico. Ci concentriamo sul miglioramento delle tue capacità attraverso programmi di flessibilità, mobilità e agilità su misura per tutte le fasce di età e disabilità.

Vogliamo che tu viva una vita che si realizza con più energia, atteggiamento positivo, sonno migliore, meno dolore, adeguato peso corporeo ed educato su come mantenere questo stile di vita. Ho fatto una vita di prendersi cura di ognuno dei miei pazienti.

Ti assicuro, accetterò solo il meglio per te ...

Se ti è piaciuto questo video e ti abbiamo aiutato in qualsiasi modo, non esitare a farlo sottoscrivi e raccomandaci.

Consiglio: Dr. Alex Jimenez - Chiropratico

Gradi di salute: http://www.healthgrades.com/review/3SDJ4

Pagina clinica di Facebook: https://www.facebook.com/dralexjimene…

Pagina dello sport di Facebook: https://www.facebook.com/pushasrx/

Pagina degli infortuni di Facebook: https://www.facebook.com/elpasochirop…

Facebook Neuropatia Pagina: https://www.facebook.com/ElPasoNeurop…

Guaire: http://goo.gl/pwY2n2

Testimonianze cliniche: https://www.dralexjimenez.com/categor…

Informazioni: Dr. Alex Jimenez - Chiropratico

Sito clinico: https://www.dralexjimenez.com

Sito lesioni: https://personalinjurydoctorgroup.com

Sito per lesioni sportive: https://chiropracticscientist.com

Back Injury Site: https://www.elpasobackclinic.com

Linked In: https://www.linkedin.com/in/dralexjim…

Pinterest: https://www.pinterest.com/dralexjimenez/

Twitter: https://twitter.com/dralexjimenez

Twitter: https://twitter.com/crossfitdoctor

Raccomandare: PUSH-as-Rx ® ™

Centro di riabilitazione: https://www.pushasrx.com

Facebook: https://www.facebook.com/PUSHftinessa…

PUSH-as-Rx: http://www.push4fitness.com/team/

Quali pazienti chiropratici vogliono sapere sulla curcumina

Quali pazienti chiropratici vogliono sapere sulla curcumina

Il dolore cronico è una delle condizioni più diffuse negli Stati Uniti, influenzando una stima 100 milioni di americani ogni anno. Per dirlo in prospettiva, questo è più del numero di persone che soffrono di cancro, malattie cardiache e diabete, combinato.

Molte di queste persone che soffrono di dolore cronico cercano sollievo oltre i prodotti farmaceutici che possono avere effetti collaterali spiacevoli e persino dannosi. Questo li ha portati a metodi naturali di gestione del dolore come la cura chiropratica e sostanze naturali come la curcumina. Per molte persone, queste opzioni di trattamento hanno portato loro sollievo dal dolore e li aiutano a tornare a uno stile di vita più normale.

Come funziona però? E, cosa più importante, può funzionare per te?

Qual è la curcumina?

curcumina per il dolore cronico el paso tx.
Erbe naturali capsule di curcuma con foglie di erbe fresche e curcumina secca in carta

La curcumina è una spezia che è un parente dello zenzero ed è un componente della curcuma. Spesso negli Stati Uniti, i termini curcumina e curcuma sono usati in modo intercambiabile. Tuttavia, la curcumina è ciò che conferisce alla curcuma il suo colore giallo brillante.

Mentre si trova spesso nei curry e in altri cibi tradizionali indiani, è anche stato usato da molto tempo per trattare una varietà di problemi di salute tra cui l'infiammazione che causa dolore nel corpo. Queste affermazioni sono state sostenute da numerosi studi che dimostrano che la gustosa spezia ha enormi benefici per la salute da offrire.

Questi studi hanno dimostrato che la curcumina ha forti proprietà anti-infiammatorie anche se il motivo per cui funziona non è stato ancora completamente compreso. Queste informazioni hanno spinto ulteriori studi per determinare l'efficacia della curcumina nel trattamento di una vasta gamma di condizioni tra cui il dolore cronico.

Uno studio ha esaminato gli effetti delle spezie sulle persone che soffrono di artrite o dolore alle articolazioni. I risultati hanno determinato che gli integratori di estratto di curcuma (curcumina) erano giusti efficace quanto l'ibuprofene nell'alleviare il dolore nei pazienti con artrosi del ginocchio. Ha contribuito a ridurre l'infiammazione che stava causando il dolore, portando il paziente al sollievo necessario.

Assunzione di curcumina per una migliore salute

È possibile ottenere integratori di curcumina o di curcuma, ma non sono disponibili informazioni di dosaggio standard. Il tuo chiropratico può consigliarti su quanto prendere e quali integratori sono i migliori.

Puoi anche usare la spezia negli alimenti che mangi e ottenere un buon po 'delle proprietà salutari in questo modo. Tuttavia, può essere più efficiente e più comodo assumere integratori di curcumina o di curcuma, specialmente quando si trattano infiammazione e dolore.

La curcumina è generalmente sicura con pochissimi effetti collaterali. Come con qualsiasi farmaco o integratore, alcune persone sono sensibili alle spezie e possono sperimentare diarrea e nausea.

Tuttavia, ciò si verifica solitamente a dosi più elevate o dopo che il paziente lo ha usato per un lungo periodo. Alte dosi possono anche rappresentare un rischio se la persona ha ulcere. Può anche irritare la pelle è applicata localmente.

Se stai pensando di incorporare la curcumina nella tua dieta quotidiana come integratore, dovresti prima parlare con il tuo dottore o chiropratico per assicurarti che sia sicuro per te. Le donne in gravidanza o in allattamento non dovrebbero assumere i supplementi.

Le persone con condizioni come diabete, problemi di colecisti, disturbi emorragici, malattie renali o problemi immunitari dovrebbero prestare particolare attenzione quando usano il supplemento. Inoltre, può interagire con farmaci come FANS, aspirina, farmaci per il diabete, statine, anticoagulanti e farmaci per la pressione del sangue, quindi parla con il tuo medico, come il tuo chiropratico, prima di prendere. Possono aggiustare il dosaggio o raccomandare alcune terapie nutrizionali per supportare meglio il supplemento.

Il tuo chiropratico può aiutarti a vivere una vita più naturale e senza dolore e integratori come la curcumina possono far parte di quel piano. Possono aiutarti a metterti sulla via di una vita ben vissuta.

Trattamento del dolore cronico

Fatti di nutrizione nella sclerosi multipla

Fatti di nutrizione nella sclerosi multipla

Molti professionisti sanitari raccomandano fortemente ai pazienti con sclerosi multipla, o SM, evitare i latticini. Diversi studi hanno dimostrato un'elevata correlazione tra SM e prodotti lattiero-caseari, in particolare il latte di mucca. A titolo di esempio, alcune delle proteine ​​nel latte di mucca sono prese di mira dalle cellule immunitarie dei pazienti con sclerosi multipla. Questi includono butirrofina e albumina di siero bovino, o BSA. Inoltre, l'iniezione di quelle stesse proteine ​​del latte vaccino in animali da esperimento ha causato la comparsa di lesioni nel loro sistema nervoso centrale.

Alcune proteine ​​nel latte di mucca imitano parte della glicoproteina oligodendrocita della mielina, o MOG, la sezione della mielina riteneva di iniziare la reazione autoimmune associata alla sclerosi multipla. Inoltre, questo può ingannare il sistema immunitario nell'avviare un attacco al MOG, causando successivamente demielinizzazione. Un altro studio di ricerca che coinvolge più di 135,000 uomini e donne negli Stati Uniti ha determinato una connessione tra il latte di mucca e il disturbo neurologico degenerativo, il morbo di Parkinson. I ricercatori hanno ipotizzato che i prodotti caseari, in particolare il latte di mucca, possono avere un effetto generalmente tossico sul tessuto nervoso.

L'intolleranza al lattosio è comune in tutta la popolazione generale ed è particolarmente frequente nelle popolazioni mediterranea, asiatica e africana. Le persone con intolleranza al lattosio sperimentano una varietà di sintomi, tra cui gonfiore, crampi, diarrea e nausea. Dati gli elevati rischi potenziali per le persone con SM che consumano prodotti lattiero-caseari, nonostante la mancanza di prove conclusive, gli operatori sanitari raccomandano di evitare il consumo di latticini, tra gli altri tipi di alimenti. Lo scopo di questo articolo è quello di discutere i fatti nutrizionali nella sclerosi multipla, compresi i tipi di alimenti che i pazienti con SM dovrebbero evitare, come i latticini.

astratto

La questione se le abitudini alimentari e lo stile di vita abbiano influenza sul decorso della sclerosi multipla (SM) è ancora oggetto di discussione, e al momento la terapia con SM non è associata ad alcuna informazione sulla dieta e sullo stile di vita. Qui mostriamo che i fattori dietetici e lo stile di vita possono esacerbare o migliorare i sintomi della SM, modulando lo stato infiammatorio della malattia sia nella SM recidivante-remittente che nella SM primitiva-progressiva. Ciò si ottiene controllando sia le vie metaboliche che quelle infiammatorie nella cellula umana e la composizione del microbiota intestinale commensale. Ciò che aumenta l'infiammazione sono diete ipercaloriche di tipo occidentale, caratterizzate da sale alto, grasso animale, carne rossa, bevande zuccherate con zucchero, cibi fritti, fibre basse e mancanza di esercizio fisico. La persistenza di questo tipo di dieta sovraregistra il metabolismo delle cellule umane verso le vie biosintetiche comprese quelle delle molecole proinfiammatorie e porta anche a un microbiota intestinale disbiotico, alterazione dell'immunità intestinale e infiammazione sistemica di basso grado. Al contrario, l'esercizio e le diete ipocaloriche basate sull'assunzione di verdure, frutta, legumi, pesce, prebiotici e probiotici agiscono su recettori nucleari ed enzimi che sovrastimolano il metabolismo ossidativo, riducono la sintesi di molecole proinfiammatorie e ripristinano o mantengono un simbiotico sano microbiota intestinale. Ora che conosciamo i meccanismi molecolari con cui i fattori dietetici e l'esercizio fisico influenzano lo stato infiammatorio della SM, possiamo aspettarci che un intervento nutrizionale con cibo anti-infiammatorio e integratori alimentari possa alleviare i possibili effetti collaterali dei farmaci immunomodulatori e dei sintomi cronici sindrome da stanchezza e quindi favorire il benessere del paziente.

parole chiave: medicina alternativa complementare, microbiota intestinale, infiammazione, stile di vita, sclerosi multipla, alimentazione

Introduzione

La sclerosi multipla (SM) è una malattia cronica, infiammatoria e autoimmune del sistema nervoso centrale (SNC), che porta a un diffuso degrado focale della guaina mielinica, a lesioni assonali e neuronali variabili ea disabilità nei giovani adulti, soprattutto donne. La malattia è caratterizzata da processi infiammatori perivascolari disseminati ed eterogenei alla barriera emato-encefalica (BBB), con il coinvolgimento di cellule T autoreattive, linfociti B, macrofagi e cellule microgliali contro la materia bianca del cervello e del midollo spinale (McFarland e Martin, 2007; Constantinescu e Gran, 2010; Kutzelnigg e Lassmann, 2014).

Anticorpi (Krumbholz et al., 2012), complemento attivato (Ingram et al., 2014), citochine, disfunzione mitocondriale (Su et al., 2009), specie reattive dell'ossigeno (ROS; Gilgun-Sherki et al., 2004), e le metalloproteinasi della matrice (MMPs, Liuzzi et al., 2002; Rossano et al., 2014) possono cooperare per produrre la patologia.

Dal punto di vista clinico, ci sono almeno due forme principali della malattia: la SM recidivante-remittente (RRMS, circa 85% dei casi clinici) e la SM primaria-progressiva (PPMS, circa 15% dei casi clinici) (Dutta e Trapp, 2014; Lublin et al., 2014). Nella RRMS, che di solito si evolve nella SM secondaria progressiva (SPMS), le recidive sono associate ad una maggiore infiammazione sistemica e formazione di lesioni nel cervello, seguite da remissioni più o meno complete, mentre la patogenesi della PPMS è caratterizzata da danni neurologici progressivi piuttosto che ricadute e remissioni.

Al momento esistono almeno terapie che modificano la malattia 10 che sono state trovate per rallentare la progressione della malattia e prevenire alcuni sintomi di disabilità, ma solo nel caso della RRMS. Tuttavia, poiché la malattia è complessa in natura e unica nel decorso individuale, nessun paziente risponde alla terapia nello stesso modo (Loleit et al., 2014). Allo stesso modo, non ci sono biomarcatori veramente affidabili che consentano a tutti di valutare l'efficacia del trattamento ed è quindi importante scoprire nuovi marcatori della malattia (Fernandez et al., 2014).

La mancanza di risposta alle terapie immunomodulatorie nel caso di PPMS, altrimenti efficace nel trattamento della RRMS, può essere dovuta a diversi meccanismi patogenici che agiscono in RRMS e PPMS. Tuttavia, questo non è vero per quanto riguarda l'infiammazione: una significativa associazione tra infiammazione e neurodegenerazione è stata osservata nel cervello non solo nella SM acuta e recidivante, ma anche nella SM progressiva secondaria e primaria (Frischer et al., 2009; Lassmann, 2013) e le lesioni attive della SM sono sempre associate all'infiammazione (Kutzelnigg e Lassmann, 2014). Pertanto, l'infiammazione deve essere l'obiettivo per il trattamento di entrambe le forme della malattia.

Collegare l'infiammazione con abitudini alimentari e stile di vita

Che cosa causa i processi infiammatori nella SM? La SM è una malattia complessa e le componenti genetiche e immunologiche non sono sufficienti a spiegare la sua origine. In realtà, la SM ha una natura multifattoriale e vari fattori ambientali o condizioni metaboliche possono avere un ruolo nel suo sviluppo (Ascherio, 2013): infezioni virali (Ascherio et al., 2012; Venkatesan e Johnson, 2014), avvelenamento da metalli pesanti (Latronico et al., 2013; Zanella e Roberti di Sarsina, 2013), fumo (Jafari e Hintzen, 2011), obesità infantile (Munger, 2013), basso stato di vitamina D (Ascherio et al., 2014), o stile di vita scorretto, incluso sbagliato abitudini alimentari (Riccio, 2011; Riccio et al., 2011; Riccio e Rossano, 2013).

Nessuno dei fattori ambientali sopra menzionati da solo può spiegare la malattia; tuttavia, le seguenti considerazioni rendono più attraente il coinvolgimento nella SM delle abitudini alimentari e dello stile di vita, piuttosto che infezioni o fumo, come fattori che possono influenzare il decorso della malattia:

  1. Distribuzione geografica: La SM è più diffusa nei paesi occidentali con il reddito più elevato e la più lontana dell'equatore. Le caratteristiche di questi paesi sono uno stile di vita sedentario, una dieta ipercalorica ricca di grassi saturi di origine animale (dieta occidentale) e bassa esposizione solare (WHO e MSIF, 2008).
  2. Effetto della migrazione: Con la migrazione da un'area ad alta incidenza di SM in un altro luogo con bassa incidenza prima dell'età di 15 anni, il basso rischio viene acquisito, mentre la migrazione dopo questa età non modifica il livello di rischio. Questo aspetto può essere collegato a fattori nutrizionali, piuttosto che a fattori ambientali infettivi o tossicologici (McLeod et al., 2011).
  3. Scarsa disponibilità di vitamina D: Un altro fattore ambientale legato alla dieta e alla distribuzione geografica è la disponibilità di vitamina D, che è più bassa alle latitudini con una minore esposizione alla luce solare. I pazienti con SM hanno un basso contenuto di vitamina D (Ascherio et al., 2014), ma questo vale anche per altre malattie infiammatorie croniche (Yin e Agrawal, 2014).
  4. Infiammazione postprandiale: L'alta percentuale di grassi animali / zuccheri alti e carboidrati raffinati è associata all'infiammazione postprandiale (Erridge et al., 2007; Ghanim et al., 2009; Margioris, 2009).
  5. Alto indice di massa corporea: Indice di massa corporea elevato (BMI) prima dell'età 20 è associato a 2 × rischio aumentato (Hedström et al., 2012). Si noti che il BMI è correlato con lo stato del microbiota intestinale.
  6. Somiglianza con altre malattie infiammatorie legate a abitudini alimentari sbagliate: La SM ha alcune somiglianze con la malattia infiammatoria intestinale (IBD, Cantorna, 2012): entrambi hanno una bassa vitamina D e sono influenzati da fattori ambientali (Dam et al., 2013). Inoltre, il glatiramer acetato (GA, o Copolymer 1 / Copaxone) è benefico in entrambe le malattie (Aharoni, 2013) e vi è un'aumentata incidenza di IBD tra i pazienti con SM.

Come il cibo influenza il decorso delle malattie infiammatorie: un approccio di base

Le osservazioni riportate sopra suggeriscono che lo stato nutrizionale può influenzare il decorso della SM. Tuttavia, sorge la domanda su come le molecole alimentari potrebbero esacerbare o migliorare i sintomi della SM, e in generale come potrebbero favorire o downregolare l'infiammazione a livello molecolare. In particolare, è importante chiarire quali sono gli obiettivi delle molecole dietetiche e dei meccanismi molecolari coinvolti, se ve ne sono.

Fondamentalmente, possiamo dire che il cibo che consumiamo ha un ampio impatto sul nostro sviluppo, comportamento, condizioni di salute e durata della vita agendo su due obiettivi principali: (A) le cellule del nostro corpo e (B) il microbiota intestinale commensale (Figura 1).

  • Da un lato, diversi tipi e quantità di fattori dietetici possono interagire con enzimi, fattori di trascrizione e recettori nucleari di cellule umane. Questo può indurre modificazioni specifiche del metabolismo cellulare verso il catabolismo o l'anabolismo e modulare le risposte infiammatorie e autoimmuni nel nostro corpo (Desvergne et al., 2006).
  • D'altra parte, dobbiamo considerare l'impatto della dieta e dello stile di vita sulla nostra microflora intestinale. Siamo infatti metaorganismi che vivono con migliaia di miliardi (1014) di cellule microbiche (approssimativamente 10 volte le cellule del nostro corpo) e migliaia di microrganismi diversi conosciuti come il microbiota intestinale. Questo complesso ecosistema è una parte essenziale del nostro organismo e influenza sia il nostro sistema immunitario che il nostro metabolismo. Pertanto, ha un forte impatto sulla nostra salute.

Nella salute, esiste una stretta relazione mutualistica e simbiotica tra il microbiota intestinale e gli esseri umani, e il microbiota intestinale fornisce una serie di utili funzioni metaboliche, protegge contro gli enteropatogeni e contribuisce alle normali funzioni immunitarie. Questo è lo stato normale del microbiota intestinale umano, chiamato eubiosi. La distorsione da eubiosi, legata a una diminuzione della biodiversità intestinale e all'aumento di batteri patogeni, è chiamata disbiosi. La conseguenza più comune di un microbiota intestinale disbiotico è l'alterazione del sistema immunitario della mucosa e l'insorgenza di malattie infiammatorie, immunitarie, metaboliche o degenerative (Chassaing e Gewirtz, 2014).

Diversi tipi e quantità di fattori dietetici stimolano la selezione di specifiche popolazioni microbiche intestinali che cambiano tipo e numero di specie microbiche verso eubiosi o disbiosi, semplicemente agendo attraverso l'alimentazione preferenziale di una o dell'altra popolazione microbica. Se la nostra dieta favorisce il passaggio a un microbiota intestinale disbiotico, questo può portare a infiammazione intestinale, alterazione dell'immunità intestinale e quindi a infiammazione sistemica e malattie infiammatorie croniche.

In che modo i fattori dietetici influenzano il metabolismo delle cellule umane e modulano l'infiammazione

Per capire in che modo le molecole alimentari possono influenzare direttamente il metabolismo delle cellule umane, è necessario descrivere prima quali sono gli enzimi e i fattori di trascrizione coinvolti nel catabolismo o anabolismo nella cellula.

Come mostrato a sinistra nella Figura 2, il metabolismo ossidativo è sovraregolato da due enzimi e un recettore nucleare. Gli enzimi sono la chinasi della proteina attivata da AMP (AMPK; Steinberg e Kemp, 2009) e la Sirtuins (SIRT), un gruppo di istoni deacilanti dell'istone, attivati ​​dal NAD + (Zhang et al., 2011; Rice et al., 2012). Il recettore nucleare è rappresentato dagli isotipi dei recettori attivati ​​dal proliferatore del perossisoma (PPARs, Desvergne e Wahli, 1999; Burns e VandenHeuvel, 2007).

Gli isotipi PPAR sovraregolano la trascrizione dei geni coinvolti nella beta-ossidazione degli acidi grassi nei mitocondri e nei perossisomi e formano una rete con le vie AMPK e Sirtuins. Il pathway AMPK-Sirtuins-PPAR è attivato da uno stile di vita basato sulla restrizione calorica e sull'esercizio fisico, nonché da alcune molecole bioattive (polifenoli, presenti in frutta e verdura e grassi polinsaturi a catena lunga omega-3 (n-3) acidi [PUFA], presenti nei pesci). Gli isotipi PPAR attivati ​​dal ligando formano complessi eterodimerici con il recettore X del retinoide (RXR), che a sua volta viene attivato dall'acido 9-cis-retinoico (RA).

Viceversa, come mostrato a destra in Figura 2-like sull'altro piatto di un equilibrio immaginario - un'elevata assunzione di nutrienti densi di energia porta alla sovraregolazione dell'anabolismo, compresa la lipogenesi e la crescita cellulare, attraverso l'attivazione dell'elemento regolatore sterol- proteine ​​leganti, SREBP-1c e SREBP-2 (Xu et al., 2013) e la proteina legante gli elementi reattivi ai carboidrati, ChREBP (Xu et al., 2013). SREBP-1c e SREBP-2 sono sotto il controllo dei recettori nucleari chiamati recettori X del fegato (LXR; Mitro et al., 2007; Nelissen et al., 2012). Gli isotipi LXR, che sono attivati ​​dai derivati ​​del colesterolo e dal glucosio, hanno un ruolo rilevante nella sintesi dei lipidi attivando SREBP-1c e la sintesi di triacilgliceroli, mentre inibiscono SREBP-2 e la sintesi del colesterolo.

Al centro della comprensione del legame tra dieta e infiammazione sono due fattori di trascrizione coinvolti nell'infiammazione e nell'autoimmunità: il fattore di trascrizione nucleare-kB (NF-kB) e la proteina attivatrice (AP-1; Yan e Greer, 2008). Nella SM, sia NF-kB che AP-1 sono attivati ​​e inducono l'espressione di diversi geni proinfiammatori e la produzione di molecole proinfiammatorie. La causa della loro attivazione nella SM non è nota ma, come mostrato nella Figura 2 per NF-kB, questo può essere attivato non solo da virus, citochine e stress ossidativo ma anche da alcuni componenti dietetici come acidi grassi saturi o trans insaturi acidi grassi, che quindi possono essere considerati proinfiammatori.

La downregolazione del NF-kB proinfiammatorio può essere ottenuta mediante il legame inibitore delle forme attivate da RA degli isotipi del recettore X del retinoide (RXRs; Pérez et al., 2012; Zhao et al., 2012; Fragoso et al., 2014 ).

Come mostrato nel centro della Figura 2 e più in dettaglio nella Figura 3, le forme attive di RA-RXR sono eterodimeri derivanti dalla loro associazione con specifici recettori nucleari attivati ​​dal ligando, vale a dire PPARs, LXRs e recettore della vitamina D (VDR).

Tutti e tre i recettori nucleari - PPAR, LXR e VDR - devono essere attivati ​​da specifici ligandi. Come indicato nella Figura 2, i ligandi possono essere specifici fattori dietetici e questo chiarisce come le cellule rispondono ai cambiamenti nello stato nutrizionale e regolano l'omeostasi energetica, ma rappresenta anche la chiave molecolare per capire come i nutrienti possono influenzare il decorso delle malattie infiammatorie croniche (Heneka et al. ., 2007; Zhang-Gandhi e Drew, 2007; Krishnan e Feldman, 2010; Cui et al., 2011; Schnegg e Robbins, 2011; Gray et al., 2012).

Pertanto, ciascuno dei tre recettori nucleari - PPAR, LXR e VDR - compete per il legame con RA-RXR e forma etero-complessi che possono inibire NF-kB ed esercitare uno stretto controllo sull'espressione di geni infiammatori, integrando così metabolismo e segnalazione infiammatoria. È chiaro che esiste una competizione tra i tre recettori PPAR, LXR e VDR-D, per il legame con RA-RXR, ma questa competizione dovrebbe avere un'influenza solo sul metabolismo e non sull'infiammazione, perché non è ancora noto quale dei tre eterodimeri è più efficace nell'inibire NF-kB.

Ovviamente, la produzione di molecole proinfiammatorie nel corso delle recidive è un processo biosintetico: è sostenuta da diete ipercaloriche e contrastata da diete ipocaloriche. In linea di principio, ciò che favorisce l'anabolismo promuoverà i processi infiammatori, mentre quello che favorisce il catabolismo li contrasterà (Figura 4).

Come i fattori dietetici influenzano la composizione e la biodiversità dell'intestino Microbiota e alterano la relazione ospite-microbiota

Il legame tra stile di vita, abitudini alimentari e composizione microbiota intestinale

La composizione della microflora intestinale è altamente individuale ed è influenzata da molti fattori come la dieta, l'attività fisica, lo stress, i farmaci, l'età e così via. Ognuno di noi ha un insieme unico di specie di batteri 100 o 150.

Un modo semplice per discutere sull'effetto del cibo e dello stile di vita sulla microflora intestinale è di limitare la panoramica a due sole divisioni batteriche dominanti - i Bacteroidetes e i Firmicutes - che rappresentano circa il 90% del totale, come è stato dimostrato che il rapporto Bacteroidetes / Firmicutes (B / F) è influenzato da abitudini alimentari a lungo termine (Cani e Delzenne, 2009; Wu et al., 2011; Lozupone et al., 2012; Tremaroli e Bäckhed, 2012; Panda et al., 2014) .

Uno studio comparativo di De Filippo et al. (2010) nei bambini di Firenze e del Burkina Faso in Africa ha dimostrato che le abitudini alimentari a lungo termine hanno effetti significativi sul microbiota intestinale umano.

In questo studio, la dieta del Burkina Faso si basava sul consumo di polisaccaridi vegetali come miglio e sorgo (10 g fibre / giorno e 662-992 kcal / giorno), mentre la dieta dei bambini italiani era in stile occidentale, a base di proteine, grassi animali, bevande zuccherate con zucchero e carboidrati raffinati (5.6 g fibre / giorno e 1,068-1,512 kcal / giorno). L'analisi dei campioni fecali nei bambini africani ha mostrato la prevalenza di Bacteroidetes (73%) - principalmente Prevotella e Xylanibacter - e bassi livelli di Firmicutes (12%). Al contrario, una prevalenza di Firmicutes (51%) rispetto ai Bacteroidetes (27%) è stata osservata nei bambini italiani, ma i Bacteroidetes sono passati da Prevotella e Xylanibacter a Bacteroides. Questi ultimi sono solitamente selezionati tra i Bacteroidetes perché possono usare anche zuccheri semplici oltre a glicani complessi e gli zuccheri semplici sono normali componenti delle diete occidentali.

In conclusione, il rapporto B / F aumenta in associazione con una dieta ricca di carboidrati complessi (non digeribili dai nostri enzimi) perché i batteri simbionti e solitamente non nocivi, come i batteri Prevotella e Xylani, amano avere glicani complessi da mangiare. I batteri che consumano glicani complessi producono butirrato, che regola verso il basso l'attivazione di NF-kB proinfiammatorio (Figura 3).

Viceversa, le diete occidentali ad alta densità energetica modificano il profilo del microbiota intestinale e aumentano la popolazione di Firmicutes (inclusi i Mollicutes), più adatti per estrarre e raccogliere energia, ma spesso patogeni (Moschen et al., 2012).

Il legame tra microbiota intestinale disbiotica e infiammazione cronica

In un microbiota intestinale disbiotico, il rapporto B / F è basso e i Firmicutes possibilmente patogeni prevalgono su Bacteroidetes (Figura 5). Il fallimento dell'equilibrio microbico e la diminuzione della biodiversità che si verifica nella disbiosi portano all'interruzione della complessa interazione tra il microbiota e il suo ospite e contribuiscono all'endotossemia di basso grado e all'infiammazione cronica intestinale e sistemica. Con l'inizio dell'infiammazione sistemica, aumenta il rischio di malattie infiammatorie croniche e immuno-mediate (Tilg et al., 2009; Brown et al., 2012; Maynard et al., 2012).

In realtà, in presenza di un microbiota disbiotico, l'endotossina intestinale / lipopolisaccaride (LPS) è aumentata, le cellule T regolatorie (Treg) sono difettose, e i recettori arilici idrocarburici e le cellule Th17 proinfiammatorie sono attivate (Cani et al., 2008; Veldhoen et al., 2008).

LPS porta alla disfunzione della barriera mucosa e colpisce altri tessuti quando il suo livello plasmatico aumenta al di sopra del siero 200 pg / ml. L'aumentata permeabilità intestinale dovuta al microbiota intestinale disbiotico può essere esemplificata dal passaggio di anticorpi IgA e IgG contro glutine e gliadina, osservati anche in pazienti con SM (Reichelt e Jensen, 2004).

Il collegamento tra il microbiota intestinale disbiotico e la sclerosi multipla

Nel nostro lavoro precedente, abbiamo proposto che il modello che collega l'alterazione del microbiota - dovuto alla dieta e allo stile di vita occidentali - e il fallimento della corretta comunicazione tra il microbiota e l'intestino, che porta all'endotossemia di basso grado e all'infiammazione sistemica autoimmune, potrebbero essere validi anche per la patogenesi della SM (Fernández et al., 2012; Riccio, 2011). Infatti, la SM condivide con altri meccanismi comuni di malattie infiammatorie croniche, tutti probabilmente basati sulla persistenza di endotossemia di basso grado correlata allo stile di vita e alle abitudini alimentari sbagliate insieme a una disbiosi latente. Inoltre, l'esistenza di un asse dell'intestino microbiota-cervello, che è ora più di un concetto emergente, suggerisce che l'intervento sul microbiota intestinale potrebbe essere una strategia fruttuosa per il trattamento futuro dei disturbi complessi del SNC (Cryan e Dinan, 2012).

Il possibile legame diretto tra il microbiota intestinale e la SM è stato dimostrato sperimentalmente da Berer et al. (2011). Usando topi transgenici, Berer et al. hanno dimostrato che i batteri intestinali commensali possono innescare una malattia autoimmune recidivante-remittente guidata da cellule CD4 + T della mielina specifiche e demielinizzazione, data la disponibilità di MOG-la glicoproteina oligodendrocita della mielina autoantigena. In un altro studio, è stato dimostrato che il trattamento antibiotico diretto ad alterare la microflora intestinale sopprime l'encefalomielite allergica sperimentale (EAE, Yokote et al., 2008).

Questi risultati suggeriscono che il microbiota intestinale può giocare un ruolo cruciale nella fase iniziale della SM e può anche predisporre la suscettibilità dell'ospite ad altre malattie autoimmuni del SNC così come a disturbi neuropsichiatrici quali autismo, depressione, ansia e stress. Sta emergendo un nuovo concetto di asse del microbiota-cervello intestinale (Wang e Kasper, 2014).

Su queste basi, la comprensione del ruolo del microbiota intestinale nella salute e nella malattia può gettare le basi per trattare le malattie croniche modificando la composizione del microbiota intestinale attraverso la scelta di uno stile di vita corretto, comprese le abitudini alimentari. Inoltre, la manipolazione diretta del microbiota intestinale può migliorare la risposta immunitaria adattativa e ridurre le secrezioni infiammatorie. Ad esempio, poiché un ruolo specifico delle cellule Th17 intestinali è stato suggerito nell'immunopatologia della SM (Sie et al., 2014), la promozione del differenziamento delle cellule Treg e la riduzione delle cellule patogene di Th17 potrebbero prevenire la recidiva dell'autoimmunità nei pazienti con SM (Issazadeh-Navikas et al. , 2012).

Per questi motivi, la scoperta che il difetto del bilancio Treg / Th17 osservato nei modelli MS è presente anche nei pazienti con SM, potrebbe avere importanti implicazioni cliniche, poiché questo difetto può essere modulato dai cambiamenti nella composizione del microbiota, che a sua volta è modulato da cambiamenti dietetici (David et al., 2014).

Fattori dietetici proinfiammatori

I componenti della dieta il cui apporto deve essere controllato per evitare l'aumento dei processi infiammatori nella SM, così come in altre malattie infiammatorie croniche, sono i seguenti:

  • Acidi grassi saturi di origine animale;
  • Acidi grassi insaturi nella configurazione trans (acidi grassi idrogenati);
  • Carne rossa;
  • Bevande zuccherate e in generale diete ipercaloriche ricche di carboidrati raffinati (a basso contenuto di fibre), oltre al grasso animale;
  • Aumento dell'assunzione di sale nella dieta;
  • Proteine ​​del latte vaccino della membrana del globulo grasso del latte (proteine ​​MFGM).

Grasso di origine animale

Gli acidi grassi saturi di origine animale, che si trovano in alimenti come latte intero, burro, formaggio, carne e salsicce, sono i componenti della dieta presi in considerazione più frequentemente per la loro influenza deleterio sul corso della SM.

In 1950, Swank ha suggerito che il consumo di grassi animali saturi è direttamente correlato con la frequenza della SM, ma un legame tra l'assunzione limitata di grasso animale e la remissione della SM è stato segnalato solo in 2003 (Swank e Goodwin, 2003). Secondo Swank e Goodwin, le diete ad alto contenuto di grassi portano alla sintesi di lipidi di stoccaggio e colesterolo e causano una diminuzione della fluidità della membrana e una possibile ostruzione dei capillari e l'insorgenza o l'aumento dell'infiammazione.

Altri studi più recenti indicano che l'azione del grasso saturo è controllata a livello trascrizionale e influenza sia l'espressione genica, il metabolismo cellulare, lo sviluppo e la differenziazione delle cellule. Più in generale, l'assunzione di grasso animale è spesso legata a un apporto calorico elevato, che è di per sé un fattore dannoso per molte malattie infiammatorie croniche. Infine, come descritto più avanti in questo articolo, un eccesso di grasso animale saturo porta a un microbiota intestinale disbiotico, disfunzione dell'immunità intestinale e infiammazione sistemica di basso grado e rappresenta una possibile causa di alcuni disturbi cronici umani.

Acidi grassi trans

Gli acidi grassi trans (TFA) sono acidi grassi insaturi che contengono almeno un doppio legame non coniugato nella configurazione trans (Bhardwaj et al., 2011).

Come prodotti di idrogenazione parziale di oli vegetali, sono stati introdotti negli 1960 per sostituire il grasso animale, ma solo molto tempo dopo si è scoperto che hanno lo stesso effetto deleterio sul metabolismo e, come gli acidi grassi saturi, aumentano i livelli di colesterolo e promuovere la formazione di grasso addominale e aumento di peso. L'assunzione di TFA è risultata essere positivamente associata all'infiammazione intestinale e alla sovraregolazione delle citochine proinfiammatorie nella polarizzazione delle cellule di Th17 (Okada et al., 2013). Inoltre, i TFA interferiscono con il metabolismo degli acidi grassi insaturi naturali, che hanno la configurazione cis.

I TFA si trovano nella margarina e in altri grassi vegetali (idrogenati) trattati, nella carne e nei prodotti dietetici dei ruminanti e negli snack. Possono essere presenti anche in patatine fritte e altri cibi fritti, in quanto si formano anche nella frittura.

Carne rossa

La carne rossa contiene più eme di ferro rispetto alla carne bianca. Il ferro è facilmente nitrosilato e questo facilita la formazione di nitroso-composti endogeni (NOCs, Joosen et al., 2010). L'assunzione di carne rossa mostra infatti una relazione dose-risposta con la formazione di NOC, mentre non esiste una tale relazione per la carne bianca. I NOC sono mutageni: inducono nitrosilazione e danno al DNA. La carne rossa trattata (conservata con nitriti) aumenta il rischio. Le amine eterocicliche si formano durante la cottura della carne ad alte temperature, ma questo non è specifico per la carne rossa (Joosen et al., 2010).

Sono stati riscontrati depositi anormali di ferro nei siti di infiammazione nella SM (Williams et al., 2012) e il consumo di carne rossa è associato a livelli più elevati di γ-GT e hs-CRP (Montonen et al., 2013).

Degno di nota, non abbiamo l'acido N-glicolilneuraminico (Neu5Gc), un importante acido sialico, perché una mutazione inattivante nel gene CMAH ha eliminato la sua espressione nell'uomo. L'incorporazione metabolica di Neu5Gc da fonti alimentari - in particolare carne rossa e latticini - può creare problemi, poiché gli esseri umani hanno anticorpi circolanti anti-Neu5Gc e questo implica la possibile associazione con l'infiammazione cronica (Padler-Karavani et al., 2008).

Infine, la carne contiene acido arachidonico (il PUFA omega-6 (n-6), che è il precursore degli eicosanoidi proinfiammatori [prostaglandine, trombossani e leucotrieni]) e attiva la via Th17 (Stenson, 2014).

Elevata assunzione di zucchero e bassa assunzione di fibre

L'elevato consumo di bevande zuccherate e cereali raffinati, con basso contenuto di fibre, aumenta rapidamente il numero di calorie e il livello di glucosio. Il successivo aumento della produzione di insulina sovraregolamenta le vie biosintetiche e inter alia la produzione di acido arachidonico e dei suoi derivati ​​proinfiammatori.

Aumento di assunzione di sale dietetico

L'aumento dell'assunzione di sale nella dieta potrebbe essere un fattore di rischio ambientale per lo sviluppo di malattie autoimmuni, poiché è stato dimostrato che può indurre cellule patogene Th17 e relative citochine proinfiammatorie in EAE (Kleinewietfeld et al., 2013; Wu et al., 2013) . Le cellule Th17 sono state coinvolte nello sviluppo della SM.

Grasso di latte vaccino e proteine ​​della membrana del globulo grasso del latte

Il grasso del latte viene disperso in modo omogeneo e protetto dall'ossidazione, grazie a una membrana composta da lipidi e proteine ​​particolari chiamate proteine ​​della membrana del globulo grasso del latte (MFGM; Riccio, 2004). Queste proteine, che rappresentano solo il 1% delle proteine ​​del latte, hanno un valore informativo piuttosto che nutrizionale. Nell'allattamento umano, sono necessari per la corretta formazione del sistema digestivo, nervoso e immunitario nei bambini. Questo flusso di informazioni non è ovviamente rilevante, o non richiesto affatto, nell'età adulta e, nel caso del latte vaccino assunto per l'alimentazione umana. Nell'età adulta, le proteine ​​MFGM del latte di mucca non hanno più un ruolo informativo e possono essere eliminate dalla dieta insieme al grasso del latte.

La rimozione delle proteine ​​MFGM dal latte vaccino intero è particolarmente rilevante nel caso della SM. La proteina MFGM più rappresentativa (40% delle proteine ​​totali MFGM), butirrofilina (BTN), è infatti sospettata di avere un ruolo nella SM, in quanto è molto simile a MOG, uno dei candidati autoantigeni nella SM. BTN e MOG condividono lo stesso comportamento nei modelli sperimentali MS e gli anticorpi cross-reattivi MOG / BTN sono stati trovati nella SM, nell'autismo e nella malattia coronarica (CHD, Riccio, 2004). Per questi motivi, il paziente con SM dovrebbe evitare l'assunzione di latte vaccino intero e preferire il latte scremato, che, inoltre, non ha grassi animali.

Un altro punto di vista è quello di Swanson et al. (2013). Hanno scoperto che le molecole di tipo BTN o BTN potrebbero avere un ruolo regolatore nell'immunità e quindi suggeriscono che le molecole di tipo BTN o BTN potrebbero essere utili per indurre lo sviluppo di Treg.

Diete ipercaloriche e infiammazione post-prandiale

Dopo ogni pasto, potremmo sperimentare uno stress ossidativo transitorio e moderato e una moderata risposta infiammatoria a seconda del tipo e della quantità di cibo. Le abitudini alimentari basate su un'esposizione frequente e persistente a pasti con alta assunzione di sale / grassi animali e bevande trans-zucchero / zuccherate stressano il nostro sistema immunitario / metabolico e il conseguente possibile fallimento dell'omeostasi può portare a disordini immunitari e metabolici di varia natura .

Presi insieme, lo stress dipendente dalla dieta potrebbe essere dovuto ai seguenti motivi: (a) apporto calorico: più alte sono le calorie, più lo stress ossidativo indotto; (b) carico glicemico di un pasto: picchi glicemici postprandiali acuti possono indurre un rilascio di insulina molto più alto del necessario; (c) schema lipidico: grasso animale saturo, acidi grassi trans e omega-6 (n-6) PUFA a catena lunga favoriscono l'infiammazione postprandiale. Come riportato nelle sezioni seguenti, l'infiammazione postprandiale è attenuata o soppressa da n-3 PUFA e polifenoli, restrizione calorica ed esercizio fisico.

Composti bioattivi naturali antinfiammatori: utili per combattere la SM e prevenire le recidive?

Specifiche molecole dietetiche bioattive sono in grado di contrastare gli effetti degli agenti patogeni microbici e di ridurre l'espressione delle molecole infiammatorie. Tra questi, i composti più importanti sono i polifenoli e i carotenoidi delle verdure, il n-3 PUFA dei pesci, le vitamine D e A, i composti tiolici come l'acido lipoico e gli oligoelementi come il selenio e il magnesio.

La maggior parte dei composti sopra menzionati, ad eccezione del PUFA, che non sono antiossidanti, sono noti per le loro proprietà antiossidanti. La motivazione per l'uso di antiossidanti nella SM si basa sull'osservazione che lo stress ossidativo è una delle componenti più importanti del processo infiammatorio che porta alla degradazione della mielina e al danno assonale. Tuttavia, è ormai noto che gli antiossidanti alimentari hanno proprietà biologiche aggiuntive che vanno ben oltre la semplice attività antiossidante. Infatti, sono in grado di contrastare gli effetti negativi degli agenti microbici e degli acidi grassi saturi o trans, sottoregolando l'espressione delle molecole proinfiammatorie, dello stress ossidativo e dell'angiogenesi.

Polifenoli

Tutti i polifenoli - che sono presenti in verdure, cereali, legumi, spezie, erbe, frutta, vino, succhi di frutta, tè e caffè - hanno proprietà antinfiammatorie, immunomodulatorie, anti-angiogeniche e antivirali e stimolano le vie cataboliche (Gupta et al., 2014; Wang et al., 2014). Si trovano nelle piante sotto forma di glicosidi, esteri o polimeri, troppo grandi per entrare nella membrana intestinale. Gli agliconi rilasciati dal microbiota intestinale sono coniugati con glucuronidi e solfati nell'intestino e nel fegato. La loro solubilità e biodisponibilità sono molto scarse (μM, Visioli et al., 2011).

Da un punto di vista strutturale, i polifenoli includono flavonoidi e molecole di non flavonoidi (Bravo, 1998). I flavonoidi più importanti sono la quercetina (cipolle, mele, agrumi e vino, Min et al., 2007; Sternberg et al., 2008), catechine (tè verde; Friedman, 2007) e daidzeina e genisteina (soia; et al., 2013; Zhou et al., 2014). I non-flavonoidi più importanti sono il resveratrolo (cioccolato, arachidi, bacche, uva nera e vino rosso; Das e Das, 2007; Cheng et al., 2009; Shakibaei et al., 2009), curcumina (spezia curcuma della famiglia di zenzero, curry ; Prasad et al., 2014) e idrossitirosolo (olio d'oliva; Hu et al., 2014).

È stato trovato che l'effetto antinfiammatorio dei polifenoli in vitro può dipendere dalla loro struttura chimica (Liuzzi et al., 2011). Pertanto, una miscela di flavonoidi e non-flavonoidi può essere più efficace della supplementazione con un solo polifenolo.

Due esempi dei polifenoli più studiati sono la quercetina e il resveratrolo. La quercetina è presente principalmente come glucoside. La maggior parte dei suoi effetti sono additivi a quelli dell'interferone β. La quercetina non è tossica, ma il suo prodotto di ossidazione, quercetina chinone, è molto reattivo verso i gruppi SH di proteine ​​e glutatione e può essere tossico (Boots et al., 2008). L'aggiunta di acido lipoico o N-acetilcisteina può limitare gli effetti tossici.

Il resveratrolo è glucuronato nel fegato e assorbito in questa forma principalmente nel duodeno ma solo in quantità molto limitata. A seconda della sua concentrazione, il resveratrolo può indurre la morte di un'ampia varietà di cellule mediante necrosi o apoptosi. A questo proposito, è comunemente accettato che il resveratrolo ha effetti neuroprotettivi; tuttavia, è stato anche riferito che può esacerbare malattie sperimentali simili alla MS (Sato et al., 2013). Queste discrepanze possono essere attribuite alle diverse concentrazioni utilizzate in vitro o biodisponibili in vivo, poiché il resveratrolo ha effetti opposti a concentrazioni di 10-5 M (proliferazione di cellule mesenchimali umane) e 10-4 M (inibizione della proliferazione). Nella nostra esperienza, il resveratrolo ha un effetto neurotrofico sui neuroni corticali in coltura solo a concentrazioni molto basse, mentre a concentrazioni più elevate può avere effetti tossici. Ma nel caso dello stress ossidativo, il resveratrolo ha proprietà neuroprotettive anche alle alte concentrazioni.

Vitamina D, vitamina A, carotenoidi, altre vitamine e oligoelementi

Altri composti e elementi che possono essere utili come integratori nella SM sono le vitamine D, A, E, C, B12 (Mastronardi et al., 2004) e niacina (Penberthy e Tsunoda, 2009) e oligoelementi come il selenio (Boosalis , 2008) e magnesio (Galland, 2010).

La vitamina D ha ruoli immuno-modulatori e rappresenta la molecola più promettente nella dieta per il trattamento di malattie infiammatorie croniche come la SM (Smolders et al., 2008; Pierrot-Deseilligny, 2009; Cantorna, 2012; Ascherio et al., 2014). Come già accennato, si ritiene generalmente che la distribuzione geografica speciale della SM nel mondo possa essere attribuita anche alla ridotta disponibilità di vitamina D3, a causa di una insufficiente esposizione alla luce solare in alcuni paesi, e la mancanza di vitamina D attiva potrebbe essere un'altra possibile causa di origine ambientale della SM. Tuttavia, bassi livelli di vitamina D attiva possono essere dovuti anche al suo metabolismo alterato o funzione non solo per l'esposizione alla luce solare. In effetti, il fallimento della supplementazione di vitamina D3 (colecalciferolo) per mostrare effetti benefici sul peso corporeo o sul decorso di malattie infiammatorie può essere dovuto alla persistenza della sua carenza nonostante la sua somministrazione.

La vitamina D3 (colecalciferolo), formatasi dopo esposizione al sole, è idrossilata nel fegato a 25- (OH) D3 (calcidiolo) dagli enzimi P450 CYP27A1 o CYP2R1, e successivamente attivata nel rene da CYP27B1 a 1α, 25- (OH ) 2 D3 (calcitriol). Quest'ultima, la forma attiva della vitamina D, è inattivata da CYP24A1 in 1α, 24,25- (OH) 3 D3 (acido calcitroico). Ciò significa che i livelli di vitamina D attiva dipendono dalle velocità relative della sua sintesi tramite CYP27B1 e dalle sue modificazioni tramite CYP24A1 (Schuster, 2011). Un'elevata espressione di CYP24A1, indotta da composti endogeni e xenobiotici, potrebbe portare a bassi livelli di vitamina D e causare o migliorare malattie infiammatorie croniche e cancro. Per questi motivi, è importante seguire il livello di vitamina D nel corso della somministrazione di vitamina D. Se i livelli di vitamina D rimangono bassi, l'espressione di mRNA di CYP24A1 deve essere esaminata e deve essere testata la determinazione delle attività di CYP27B1 e CYP24A1 e la loro inibizione (Chiellini et al., 2012, Kósa et al., 2013).

Un altro aspetto importante riguarda il VDR. Il metabolita attivo della vitamina D-1α, 25-diidrossivitamina D-si lega a VDR e il complesso VDR-D controlla l'espressione di diversi geni coinvolti in processi di potenziale rilevanza per le malattie croniche. Come rappresentato nelle figure 2 e and3,3, il complesso VDR-D compete con i PPAR o LXR attivati ​​dal ligando per il legame con RA-RXR. I complessi eterodimerici si legano al fattore di trascrizione proinfiammatorio NFkB e riducono la sintesi delle molecole proinfiammatorie. In questo contesto, quando si valuta l'efficacia della supplementazione di vitamina D nel corso della SM, si dovrebbero considerare gli eventuali polimorfismi che interessano il VDR, che è stato recentemente associato con obesità, infiammazione e alterazioni della permeabilità intestinale (Al-Daghri et al. , 2014).

Inoltre, la scoperta che VDR-D attiva Sirtu SIRT-1 (An et al., 2010; Polidoro et al., 2013) suggerisce che la vitamina D ha un'influenza anche sul metabolismo cellulare e quindi può avere proprietà simili a quelle di molti altri integratori alimentari naturali: sovraregolano il metabolismo ossidativo e riducono l'infiammazione.

Infine, va considerato che ci sono differenze tra i dati negli esseri umani e i modelli sperimentali. In realtà, nell'uomo, a differenza dei topi, l'obesità è associata a uno scarso stato di vitamina D (Bouillon et al., 2014).

Tra i carotenoidi, il più importante è il licopene (pomodoro, anguria e rosa, Rao e Rao, 2007). Oltre ad essere un antiossidante molto potente, il licopene può dare beta-carotene e acido retinoico, e quest'ultimo può attivare il recettore RXR (Figura 2). Sebbene l'assunzione più elevata di carotenoidi, vitamina C e vitamina E non riducano il rischio di sclerosi multipla nelle donne (Zhang et al., 2001), la rilevanza del licopene e della vitamina A contro l'infiammazione non può essere ignorata.

Omega-3 (n-3) Acidi grassi essenziali e acidi grassi polinsaturi da verdure, frutti di mare e olio di pesce

n-3 acidi grassi essenziali (EFA) e PUFA rappresentano una valida alternativa agli acidi grassi saturi di origine animale.

Gli oli vegetali e vegetali contengono gli acidi grassi essenziali acido linoleico (n-6) e acido linolenico (n-3). Gli acidi grassi n-6 e n-3 hanno effetti opposti e la loro presenza nella dieta dovrebbe essere equivalente (Schmitz e Ecker, 2008). Tuttavia, nelle diete occidentali, il rapporto n-6 / n-3 aumenta da 6 a 15 e ciò porta a una maggiore incidenza di malattie cardiovascolari e infiammatorie. Infatti, l'acido linoleico porta alla formazione di acido arachidonico (20: 4), il precursore degli eicosanoidi proinfiammatori prostaglandine-2, leucotrieni-4 e trombossani-2. La sintesi di questi eicosanoidi è favorita dall'insulina e inibita dall'aspirina, così come dall'EPPA EFA a catena lunga n-3 (acido eicosapentaenoico) e DHA (acido docosaesaenoico), che derivano dall'acido linolenico n-3.

Sia il DHA che l'EPA si trovano nei frutti di mare e nell'olio di pesce. Entrambi mostrano notevoli attività antinfiammatorie, antitrombotiche e immunomodulatorie, paragonabili a quelle delle statine (Calder, 2006; Farooqui et al., 2007). n-3 PUFA inibisce i processi infiammatori e la sintesi di acidi grassi e colesterolo, e invece stimola l'ossidazione degli acidi grassi. Su questa base, nelle malattie infiammatorie croniche come la SM, n-3 gli acidi grassi essenziali (EFA) e n-3 PUFA dovrebbero prevalere nella dieta rispetto agli acidi grassi n-6. È interessante notare che il DHA è presente in alte concentrazioni nel cervello e che i suoi livelli diminuiscono nei pazienti con SM.

Nelle cellule microgliali coltivate attivate da LPS, l'olio di pesce è efficace quanto l'interferone-β nell'inibire l'espressione di MMP-9 (gelatinasi B), un importante mediatore della neuroinfiammazione (Liuzzi et al., 2004, 2007). Inoltre, n-3 PUFA ha ridotto significativamente i livelli di MMP-9 in pochi studi clinici, indicando che n-3 PUFA può rappresentare un buon trattamento complementare nel corso della SM (Weinstock-Guttman et al., 2005; Mehta et al., 2009 ; Shinto et al., 2009). Si è anche scoperto che l'olio di pesce migliora le prestazioni motorie nei cuccioli di ratto sani (Coluccia et al., 2009).

n-3 PUFA agisce in sinergia con l'aspirina su enzimi AMPK e COX ma con meccanismi diversi. Degno di nota, in presenza di aspirina, EPA e DHA formano nuove molecole bioattive anti-infiammatorie denominate resolvins, protectine e maresine, che sono in grado di ridurre l'infiammazione cellulare e il dolore infiammatorio (Xu et al., 2010; Hong e Lu, 2013; Serhan e Chiang, 2013). Questo può essere un aspetto rilevante legato all'intervento nutrizionale nella SM. In effetti, i processi infiammatori associati alla SM potrebbero essere anche dovuti al basso rapporto omega-3 (anti-infiammatorio) / omega 6 (infiammatorio) PUFA e quindi alla bassa produzione di quantità adeguate di molecole che provocano la risoluzione lipoxins, resolvins, e protettori che sopprimono l'infiammazione. Quindi, la somministrazione di omega-3 PUFA insieme all'aspirina o direttamente di lipossine, resolvine e protidi può costituire un nuovo approccio nella prevenzione e nel trattamento della SM e di altre malattie neuroinfiammatorie. Inoltre, altri eicosanoidi antinfiammatori e antiangiogenici possono anche essere prodotti dagli enzimi P450 CYP da EPA e DHA (Yanai et al., 2014). In questo contesto, si dovrebbe tenere in considerazione che le statine possono interferire negativamente con il metabolismo di n-3 e n-6, poiché possono diminuire il rapporto n-3 / n-6. Pertanto, il trattamento con statine deve essere associato alla supplementazione di n-3 PUFA (Harris et al., 2004).

Gli oli di semi, da girasole, mais, soia e sesamo, contengono più acidi grassi n-6 rispetto agli acidi grassi n-3 e pertanto la loro assunzione dovrebbe essere limitata nella SM, al fine di limitare il livello di produzione di eicosanoidi proinfiammatori. D'altra parte, l'olio di cocco ha un alto contenuto di acidi grassi saturi. Tra gli oli vegetali, l'olio d'oliva dovrebbe essere preferito per il buon rapporto tra acidi grassi saturi e insaturi e perché contiene l'antiossidante idrossitirosolo.

Composti tiolici come integratori alimentari

I composti contenenti gruppi tiolici (-SH) come l'acido α-lipoico (ALA), il glutatione e la N-acetilcisteina (NAC) devono essere presi in considerazione come possibili integratori alimentari da utilizzare per il trattamento complementare della SM.

Come polifenoli, ALA (Salinthone et al., 2008; piante verdi e alimenti per animali) ha proprietà immunomodulatorie e antinfiammatorie. ALA stabilizza l'integrità del BBB e stimola la produzione di cAMP e l'attività della proteina chinasi A. Anche il NAC potrebbe essere utile nei disturbi neurologici. Passa attraverso il BBB e protegge dall'infiammazione (Bavarsad Shahripour et al., 2014).

La dieta mediterranea

Una recente revisione sistematica e una meta-analisi di studi di intervento dimostrano che i modelli di dieta mediterranea riducono l'infiammazione e il rischio di mortalità cardiovascolare e migliorano le funzioni endoteliali (Schwingshackl e Hoffmann, 2014). Questi risultati sono tanto incoraggianti quanto pensate che la vera dieta mediterranea sia leggermente diversa da quella attualmente descritta.

È generalmente riconosciuto che la dieta mediterranea si basa sul consumo di olio extravergine di oliva, cereali non raffinati, legumi, verdure diverse (in particolare pomodori) e frutta, prodotti caseari (principalmente come formaggio pecorino, ricotta, mozzarella e yogurt), pesce e prodotti della pesca e basso consumo di grassi animali e carne. Tuttavia, attualmente, la dieta mediterranea tende ad un consumo elevato di pasta e pane, il che significa un elevato apporto di glutine.

Una volta, nella vera dieta mediterranea, nel Sud Italia, la carne veniva mangiata due o al massimo tre volte alla settimana, solo l'olio d'oliva era usato per cucinare (qualità extra vergine e il più possibile crudo), ma in particolare l'assunzione di glutine era circa metà rispetto all'attuale consumo. La pasta veniva consumata con la classica salsa di pomodoro fatta in casa, ma in alternativa veniva spesso mescolata con altri alimenti senza glutine. Le ricette più comuni erano pasta e patate; pasta con fagiolini o carciofi, zucchine, melanzane, rape o cavoli; pasta con un mix di verdure e legumi (minestrone: zuppa di verdure); e pasta con ceci, fagioli o lenticchie. Le bevande zuccherate zuccherate di oggi non erano conosciute. Un'alta assunzione di alimenti ricchi di glutine può portare a una sensibilità al glutine asintomatica del glutine, a danni intestinali della mucosa, a cambiamenti nel microbiota intestinale ea infiammazioni intestinali di basso grado. In conclusione, la dieta mediterranea è buona, ma l'assunzione di glutine deve essere limitata e deve essere cereali integrali.

Stile di vita infiammatorio e antinfiammatorio

Fumo (Proinfiammatorio)

Solo pochi studi sono stati condotti sull'impatto del fumo sul corso della SM ei risultati sono contrastanti, forse perché i suoi effetti sono difficili da accertare e enucleati da altri fattori. Weiland et al. (2014) non hanno trovato alcuna associazione tra fumo e tasso di recidiva o attività della malattia, ma non escludono che i fumatori possano avere una qualità della vita significativamente più bassa della salute rispetto ai non fumatori, mentre Manouchehrinia et al. (2013) ha scoperto che il fumo è associato a una malattia più grave.

Tuttavia, come mostrato nella Figura 2, ci si può aspettare che il fumo di sigaretta possa peggiorare il decorso della SM, poiché potrebbe inibire l'attività antinfiammatoria dei Sirtuins (Caito et al., 2010). Lo stress ossidativo e carbonilico indotto dal fumo di sigaretta può essere invertito dal resveratrolo (Liu et al., 2014).

Consumo di alcol (Proinfiammatorio)

Studi recenti mostrano che il consumo di alcool (birra, vino o liquori) non è associato al rischio di SM (Massa et al., 2013; Hedström et al., 2014). Tuttavia, come mostrato nella Figura 2, l'alcol può inibire Sirtu SIRT1 e attivare l'attività trascrizionale di SREBP-1c (You et al., 2008), promuovendo così la biosintesi dei lipidi e dell'infiammazione a spese del metabolismo ossidativo.

Ci sono altri due aspetti dell'etanolo che dovrebbero essere considerati. Innanzitutto, il metabolismo dell'etanolo converte un gran numero di molecole NAD + in NADH, limitando la disponibilità di NAD + richiesto per l'attività dei sirtuins. Secondo, come substrato degli enzimi P450, l'etanolo può interferire con il metabolismo dei farmaci, che vengono trasformati dagli stessi enzimi. Il risultato potrebbe essere il prolungamento e il potenziamento dell'azione della droga. Complessivamente, l'alcol deve essere considerato come una molecola che interferisce con il normale metabolismo e facilita il processo infiammatorio, complicando la possibilità di migliorare il benessere del paziente.

Restrizione calorica (antinfiammatoria)

L'apporto ipercalorico e un pasto ricco di carboidrati e zuccheri raffinati aumentano il livello di insulina e favoriscono la biosintesi, compresa la produzione di molecole proinfiammatorie e la produzione di radicali liberi. La restrizione calorica, ottenuta diminuendo l'assunzione di cibo o mediante digiuno intermittente (un giorno e l'altro no), aumenta il livello di SIRT1 (Zhang et al., 2011), aumenta il livello di AMP e aumenta l'AMPK, aumenta i livelli di adiponectina e aumenta o attivare i suoi recettori (Lee e Kwak, 2014) e ridurre il danno ossidativo, l'attivazione dei linfociti e la progressione di modelli sperimentali di SM (Piccio et al., 2008, 2013). Gli effetti della restrizione calorica possono essere imitati dagli agonisti (resveratrolo e altri polifenoli), agendo sugli stessi bersagli (SIRT1, AMPK).

Esercizio fisico (antinfiammatorio)

L'esercizio fisico è ormai una pratica quasi accettata anche per i pazienti con sclerosi multipla e viene comunemente applicato per ridurre i sintomi di affaticamento cronico e prevenire o rallentare l'insorgenza della disabilità. Tuttavia, l'importanza dell'esercizio fisico va oltre quella della semplice attività muscolare e dovrebbe essere considerata piuttosto in un contesto olistico in cui dieta, esercizio fisico, terapia e interscambio sociale giocano tutti un ruolo per il benessere dei pazienti con SM (Gacias e Casaccia, 2013).

L'OMS (2010) ha proposto un controllo dietetico e una pratica di esercizio per attenuare o prevenire le malattie croniche umane.

Da un punto di vista molecolare, l'esercizio fisico esercita il suo effetto benefico agendo sull'asse AMPK della protein chinasi e sulla rete AMPK-Sirtuins-PPAR-δ, sovraregolando il metabolismo ossidativo e sottoregolando i percorsi biosintetici e l'infiammazione (Narkar et al., 2008). Poiché AMPK ha un ruolo chiave nel bilancio energetico, è importante menzionare i suoi agonisti. Gli agonisti di resveratrolo e AMPK come la metformina, un farmaco usato nel diabete di tipo 2, possono imitare o migliorare l'effetto dell'attività fisica e sono efficaci nell'encefalite sperimentale (Nath et al., 2009).

L'esercizio fisico influenza la qualità della vita e può stimolare la produzione di citochine anti-infiammatorie (Florindo, 2014). Inoltre, l'esercizio fisico riduce i livelli plasmatici di leptina e riduce l'espressione genica dei recettori della leptina nel fegato (Yasari et al., 2009), aumentando i livelli di adiponectina e l'attività dei recettori dell'adiponectina (Lee e Kwak, 2014).

L'associazione tra esercizio fisico e restrizione calorica porta ad una riduzione significativa dei marcatori infiammatori (Reed et al., 2010).

Studi recenti condotti su topi maschi adulti C57BL / 6 J hanno dimostrato che l'esercizio stimola l'attività mitocondriale del cervello, potenzia la neuroplasticità ed è associato al miglioramento dell'umore, in quanto diminuisce i comportamenti ansiosi in campo aperto ed esercita effetti di tipo antidepressivo nella coda test di sospensione (Aguiar et al., 2014). Altri studi condotti su ratti hanno dimostrato che l'esercizio fisico può alterare la composizione e la diversità dei batteri intestinali (Petriz et al., 2014).

Per questi motivi, i pazienti affetti da sclerosi multipla dovrebbero praticare un lieve esercizio fisico (camminare a passo svelto, nuotare o persino ballare), se possibile nel corso di un programma di riabilitazione.

Sperimentazioni cliniche nutrizionali nella SM fino ad ora

Sfortunatamente, gli studi clinici nutrizionali nella SM sono solo pochissimi. Alcuni di questi erano basati su diete a basso contenuto di grassi saturi, senza integratori (Swank e Goodwin, 2003) o con integratori di grassi omega-3 (Nordvik et al., 2000; Weinstock-Guttman et al., 2005). Altre sperimentazioni cliniche si basavano esclusivamente sulla somministrazione di singoli integratori alimentari: vitamina D o olio di pesce (n-3 PUFA) o acido lipoico. Le prove cliniche con singoli polifenoli sono state eseguite solo nel cancro. Gli integratori alimentari non sono mai stati usati insieme e non sono mai stati associati alla prescrizione dietetica.

Presi insieme, i tentativi clinici di chiarire il ruolo dell'alimentazione nella SM sono stati considerati solo promettenti di scarsa qualità o senza risultati chiari (Farinotti et al., 2007, 2012). In particolare, come riportato da Farinotti et al. nella loro revisione Cochrane (2012), integratori come n-3 PUFA sembrano non avere alcun effetto importante sul principale esito clinico nella SM, ma possono ridurre la frequenza delle recidive negli anni 2. I dati disponibili sono stati considerati insufficienti o di qualità incerta per valutare un effetto reale dell'integrazione con PUFA. In alcuni studi, sono stati riscontrati lievi benefici nei risultati di recidiva con acidi grassi omega-6, ma i dati erano caratterizzati dalla ridotta validità degli endpoint. In generale, la qualità della prova è risultata scadente. Gli studi sull'integrazione vitaminica non sono stati analizzati poiché nessuno ha soddisfatto i criteri di ammissibilità, principalmente a causa della mancanza di esiti clinici. Pertanto, mancano prove sui benefici e sui rischi dell'integrazione vitaminica e degli integratori antiossidanti nella SM.

Suggerimenti per un intervento nutrizionale nella SM: la scelta della dieta e dei supplementi dietetici

Alla fine, l'obiettivo di un intervento nutrizionale nella SM deve essere il controllo dell'infiammazione e questo, come mostrato in questa recensione, può essere ottenuto principalmente controllando l'infiammazione postprandiale, la composizione del microbiota intestinale e l'infiammazione intestinale e sistemica e l'immunità. Questo può essere ottenuto con un intervento dietetico a lungo termine, con una dieta ipocalorica, prebiotici, probiotici e integratori alimentari.

Come riportato in questo articolo, molecole dietetiche sane, restrizione calorica ed esercizio fisico sono in grado di dirigere il metabolismo cellulare verso il catabolismo e ridurre l'anabolismo e l'infiammazione interagendo a diversi livelli con enzimi specifici, recettori nucleari e fattori di trascrizione. Inoltre, in associazione con la fibra, possono spostare la disbiosi intestinale in eubiosi.

Di conseguenza, i pasti ipocalorici (1,600-1,800 kcal) a base di verdure, cereali integrali, legumi, frutta e pesce possono rallentare la progressione della malattia e migliorare il benessere dei pazienti affetti da SM, mentre le diete ipercaloriche con elevato consumo di sale, grassi animali saturi, cibi fritti e bevande zuccherate possono portare all'infiammazione postprandiale e all'infiammazione sistemica di basso grado.

La dieta deve essere integrata con prebiotici, probiotici, vitamine specifiche (D, A, B12 e acido nicotinico), oligoelementi (magnesio e selenio) e integratori alimentari come polifenoli, n-3 PUFA e acido lipoico.

I prebiotici per la SM dovrebbero includere inulina, crusca, lattosucrosi e oligofruttosio, nutrienti preferenziali per i colonociti e in grado di inattivare NF-kB. I probiotici, come lactococcus lactis, bifidobacterium lactis e clostridium butyricum, che possono migliorare l'equilibrio microbico intestinale, possono essere utilizzati per modificare la composizione del microbiota del colon. La combinazione di prebiotici e probiotici è altamente raccomandata. Le funzioni intestinali e il peso dovrebbero essere sempre sotto controllo.

Un approccio terapeutico più drastico volto a ripristinare eubiosi intestinale e downregulate l'infiammazione può essere rappresentato da trapianto di microbiota fecale (FMT; Smits et al., 2013). Il metodo sembra essere molto efficace ma ancora primitivo, non del tutto sicuro, e in un certo senso anche disgustoso. Il campo dovrebbe andare oltre i trapianti fecali, identificare gli organismi che possono essere essenziali per una particolare condizione e fornire quegli organismi in un modo molto più semplice di FMT ("Critical Views in Gastroenterology & Hepatology", 2014).

Gli integratori alimentari, con l'unica eccezione di omega-3 PUFA, che sono normali costituenti del nostro corpo, sono utili all'inizio dell'intervento nutrizionale o, nel corso delle recidive, per facilitare il recupero di una condizione salutare, ma il loro uso dovrebbe essere limitato a un periodo di tempo limitato (3-4 mesi). Questo è particolarmente valido per i polifenoli. I polifenoli non sono molecole note per quanto riguarda la loro biodisponibilità e i loro effetti biologici e devono essere utilizzate precauzioni speciali quando si completa la dieta con loro. Da un lato, possono downregolare la sintesi di molecole proinfiammatorie nel corso di processi infiammatori; d'altra parte, possono stimolare l'attività cellulare nelle cellule di riposo, ma una stimolazione persistente può indurre l'apoptosi delle cellule sane. Nel loro insieme, queste considerazioni suggeriscono che la somministrazione di polifenoli purificati dovrebbe essere eseguita sulla base di studi clinici preliminari per testare la loro efficacia come integratori alimentari e per determinare la loro sicurezza a lungo termine e il giusto dosaggio.

In generale, un intervento nutrizionale con alimenti antinfiammatori e integratori alimentari diminuisce la biosintesi dei composti proinfiammatori e rende quindi più efficace l'uso di farmaci immunomodulatori, e alla fine potrebbe limitare i loro possibili effetti avversi, alleviare i sintomi della sindrome da stanchezza cronica, e favorire il benessere del paziente. Tuttavia, dieta e integratori alimentari non dovrebbero essere trattati come farmaci e come sostituti della terapia. Allo stesso modo, il cibo proinfiammatorio non è tossico e non è necessario escluderlo del tutto. Puoi mangiare una bella bistecca o cibo fritto senza rischi o sensi di colpa, se sei in condizioni sostanzialmente salutari. Ciò che fa male sono le abitudini alimentari sbagliate a lungo termine.

Dr Jimenez White Coat

La sclerosi multipla, o SM, è una malattia cronica progressiva che comporta danni alle guaine mieliniche delle cellule nervose. L'epidemiologia della SM suggerisce che vari fattori sono spesso coinvolti nell'espressione clinica del problema di salute. Tuttavia, numerosi studi di ricerca hanno principalmente valutato il ruolo della dieta sullo sviluppo della sclerosi multipla. Per diversi anni, gli operatori sanitari hanno ritenuto che esistesse una correlazione tra il consumo di prodotti lattiero-caseari nei pazienti con sclerosi multipla. Secondo diversi studi di ricerca, è stata trovata una correlazione significativa tra latte vaccino e la prevalenza della sclerosi multipla, suggerendo un possibile ruolo dei prodotti lattiero-caseari nell'eziologia multifattoriale della SM. Dr. Alex Jimenez DC, CCST

Conclusioni

Quindi, a prima vista, la SM non sembra avere alcuna delle caratteristiche delle malattie infiammatorie croniche, che potrebbero essere correlate a abitudini alimentari e stili di vita sbagliati, o anche a un microbiota intestinale disbiotico. Apparentemente non c'è nulla in una esacerbazione della malattia che possa essere collegata al cibo o allo stato del microbiota intestinale. Infatti, quando iniziammo i nostri studi sull'impatto della nutrizione sulla SM, non c'era nemmeno la più pallida idea che potesse esistere un vero legame tra loro, e l'idea del coinvolgimento del microbiota intestinale nella SM era considerata solo molto speculativa. Ad oggi, l'idea che le abitudini alimentari possano influenzare il corso della SM sta ancora cercando di imporsi. Non così nelle malattie cardiovascolari e in altre condizioni infiammatorie croniche, in cui l'influenza delle abitudini alimentari è quasi accettata, e nemmeno nel cancro, che è sempre più considerato come una malattia metabolica (Seyfried et al., 2014).

Allo stato attuale, la terapia con SM non è associata ad alcuna dieta particolare, probabilmente a causa della mancanza di informazioni sugli effetti della nutrizione sulla malattia. Tuttavia, la maggior parte dei pazienti con SM sta cercando trattamenti complementari e alternativi (CAM), e in particolare sta cercando di cambiare le abitudini alimentari, quasi senza il parere del medico (Schwarz et al., 2008; Leong et al., 2009 ). Un recente studio basato sui dati forniti dai pazienti con SM in risposta a un questionario sulle loro abitudini alimentari sembra supportare un'associazione significativa di abitudini alimentari sane con una migliore qualità della vita fisica e mentale correlata alla salute e un livello inferiore di disabilità (Hadgkiss et al. ., 2014). Questi dati rafforzano l'idea della necessità di studi randomizzati e controllati sull'intervento nutrizionale per le persone con SM. Va sottolineato che i trattamenti nutrizionali dovrebbero essere complementari, ma non alternativi alla terapia, essere parte di un approccio olistico ed essere eseguiti sotto controllo medico.

Poiché non ci sono ancora dati disponibili dagli studi clinici, il nostro lavoro è finalizzato a razionalizzare le scelte dietetiche sulla base degli effetti noti e stabiliti dei fattori dietetici e dello stile di vita a livello molecolare. I dati riportati nella figura 2 non sono ovviamente completi, ma possono essere utili per fornire linee guida per gli interventi nutrizionali. In linea di principio, il cibo proinfiammatorio sovraregolamenta le vie biosintetiche e infiammatorie, come mostrato a destra e nella parte inferiore della Figura 2, mentre il cibo anti-infiammatorio aumenta il metabolismo ossidativo e diminuisce l'anabolismo e l'infiammazione.

Come mostrato in questo articolo, la scoperta che la restrizione calorica, l'esercizio fisico e particolari fattori dietetici possono influenzare il grado di risposta infiammatoria agendo sia sul metabolismo cellulare (Figura 2) che sulla composizione del microbiota intestinale (Figura 5), suggerisce che un adeguato nutrizionale l'intervento può migliorare il decorso della malattia e può quindi essere preso in considerazione come possibile trattamento complementare nella SM. Poiché l'infiammazione è presente sia in RRMS che in PPMS, i consigli nutrizionali sono indicati per entrambe le forme della malattia. Ciò è particolarmente importante nel caso di PPMS, per il quale non è attualmente disponibile alcuna cura. Viceversa, poiché le abitudini alimentari specifiche possono essere dannose e possono favorire uno stato cronico di infiammazione di basso grado, una dieta sbagliata può essere considerata una possibile causa di recidiva nella SM.

Presi insieme, ora abbiamo una migliore conoscenza della possibile influenza dei fattori dietetici sul metabolismo cellulare e sul microbiota intestinale e sui loro possibili effetti sulla malattia, ma, chiaramente, stiamo appena iniziando a capire il ruolo della nutrizione e del microbiota intestinale nella SM e molto lavoro rimane in termini di comprensione della natura delle interazioni del microbiota intestinale con il sistema immunitario dell'ospite, specialmente nei siti distali dell'intestino.

Per questi motivi, le prospettive future nella ricerca sulla SM dovrebbero riguardare i seguenti punti: (a) valutare la composizione del microbiota intestinale; (b) valutare i difetti nel sistema immunitario intestinale; (c) chiarire il ruolo dei polifenoli e del metabolismo della vitamina D; (d) studiare l'impatto di fattori dietetici, erbe e droghe su AMPK, Sirtuins, PPAR o direttamente su NF-kB. Degno di nota, alcuni farmaci usati per trattare il diabete di tipo II, come gli agonisti PPAR-γ i tiazolidinedioni (Bernardo et al., 2009) e l'agonista metformina AMPK (Nath et al., 2009) hanno effetti anti-infiammatori paragonabili a quelli di fattori dietetici anti-infiammatori; (e) definire possibili interferenze tra integratori alimentari e farmaci per la SM; (f) promuovere una campagna finalizzata a educare sull'importanza di seguire una dieta sana durante la terapia, ad esempio incoraggiando i pazienti a includere fibre o carboidrati complessi nella loro dieta, integrando con probiotici, scegliendo i grassi n-3 sui grassi pro-infiammatori n-6 e limitando il consumo di carne e grassi animali. La scelta di buone ricette, come quelle descritte da Mollie Katzen (2013), può rendere la dieta più accettabile.

Complessivamente, le terapie convenzionali SM immunomodulatorie hanno avuto quasi successo; tuttavia, mancano ancora farmaci che possano proteggere e favorire i meccanismi di riparazione. Possiamo decidere di aiutare le persone a mantenersi in salute fornendo indicazioni nutrizionali e opportunità di attività fisica. Per il momento, ci sono solo buone prospettive per migliorare il benessere dei pazienti con SM. Siamo solo all'inizio della storia.

sommario

Poiché sia ​​la SM recidivante-remittente che la SM primaria-progressiva sono malattie infiammatorie, possono essere influenzate da abitudini e stile di vita proinfiammatori o antinfiammatori attraverso la loro azione sul metabolismo cellulare e sul microbiota intestinale. I consigli nutrizionali per i pazienti con SM possono favorire il loro benessere.

Dichiarazione di interessi in conflitto

Gli autori non hanno dichiarato potenziali conflitti di interesse rispetto alla ricerca, paternità e / o pubblicazione di questo articolo.

Finanziamento

Gli autori hanno comunicato di aver ricevuto il seguente supporto finanziario per la ricerca, la paternità e / o la pubblicazione di questo articolo: Questo lavoro è supportato dalla Fondazione Italiana per la Sclerosi Multipla (FISM) con sovvenzioni 2007 / R / 15 per il Progetto "Sane e Alimenti funzionali per pazienti con SM, "2010 / R / 35 per il progetto" La base molecolare per l'intervento nutrizionale nella sclerosi multipla "e 2014 / S / 2 (2014-2015) per il progetto" Fatti nutrizionali nella sclerosi multipla: perché essi Sono importanti e come dovrebbero essere gestiti "a PR

Molti medici raccomandano fortemente che i pazienti affetti da sclerosi multipla, o SM, evitino i latticini perché vari studi di ricerca hanno dimostrato un'elevata correlazione tra SM e prodotti caseari, in particolare il latte vaccino. Ciò è in gran parte dovuto al fatto che le proteine ​​nel latte vaccino sono generalmente prese di mira dal sistema immunitario dei pazienti con sclerosi multipla. Inoltre, alcune proteine ​​nel latte di mucca imitano parte della glicoproteina oligodendrocita della mielina, o MOG, la sezione della mielina che innesca la risposta autoimmune nella sclerosi multipla che può ingannare il sistema immunitario per attaccare e distruggere il MOG. Informazioni riferite dal Centro nazionale per le informazioni sulle biotecnologie (NCBI). Lo scopo delle nostre informazioni è limitato ai problemi di salute chiropratica e spinale. Per discutere l'argomento, non esitate a chiedere al Dr. Jimenez o contattaci a 915-850-0900 .

A cura di Dr. Alex Jimenez

Riferito da: Ncbi.nlm.nih.gov/pmc/articles/PMC4342365/

Pulsante Green Call Now H .png

Discussione aggiuntiva sull'argomento: mal di schiena acuto

Mal di schiena è una delle più diffuse cause di disabilità e giorni persi al lavoro in tutto il mondo. Il dolore alla schiena è il secondo motivo più comune per le visite di un medico, superate solo dalle infezioni delle alte vie respiratorie. Circa il 80 percento della popolazione subirà un dolore alla schiena almeno una volta nella vita. La colonna vertebrale è una struttura complessa composta da ossa, articolazioni, legamenti e muscoli, tra gli altri tessuti molli. Lesioni e / o condizioni aggravate, come dischi erniciati, può eventualmente portare a sintomi di mal di schiena. Le lesioni sportive o gli incidenti automobilistici sono spesso la causa più frequente di mal di schiena, tuttavia a volte il più semplice dei movimenti può avere risultati dolorosi. Fortunatamente, le opzioni di trattamento alternative, come la cura chiropratica, possono aiutare ad alleviare il mal di schiena attraverso l'uso di aggiustamenti spinali e manipolazioni manuali, in definitiva migliorando il sollievo dal dolore.

foto di blog del fumetto carta ragazzo

EXTRA EXTRA | ARGOMENTO IMPORTANTE: consigliato El Paso, TX Chiropractor

***

Esercizio e progressione della malattia nella sclerosi multipla

Esercizio e progressione della malattia nella sclerosi multipla

Può esercitare rallentare la progressione della sclerosi multipla? Sclerosi multipla, o SM, è una malattia neurologica cronica caratterizzata da danni alle guaine mieliniche delle cellule nervose nel sistema nervoso centrale, o CNS. I sintomi comuni della sclerosi multipla comprendono dolore, affaticamento, perdita della vista e coordinazione compromessa. L'esercizio è spesso raccomandato come una forma di trattamento per diversi tipi di lesioni e / o condizioni, tra cui la SM. Mentre l'esercizio fisico è stato determinato per aiutare a migliorare la gestione dei sintomi della sclerosi multipla oltre a diminuire la progressione della malattia, sono ancora necessarie ulteriori prove. Lo scopo del seguente articolo è dimostrare come l'esercizio fisico può influenzare la progressione della malattia della sclerosi multipla e migliorare la qualità della vita nei pazienti.

astratto

È stato suggerito che l'esercizio (o attività fisica) potrebbe avere un potenziale impatto sulla patologia della sclerosi multipla (SM) e quindi rallentare il processo patologico nei pazienti con sclerosi multipla. L'obiettivo di questa revisione della letteratura è stato quello di identificare la letteratura che collega l'esercizio fisico (o attività) e la progressione della malattia della SM. Una ricerca bibliografica sistematica è stata condotta nei seguenti database: PubMed, SweMed +, Embase, Cochrane Library, PEDro, SPORTDiscus e ISI Web of Science. Diversi approcci metodologici al problema sono stati applicati tra cui studi longitudinali di esercizi (1) che valutano gli effetti sulle misure di esito clinico, studi trasversali (2) che valutano la relazione tra stato di forma fisica e risultati della RMN (3) studi trasversali e longitudinali valutare la relazione tra esercizio / attività fisica e disabilità / tasso di recidiva e, infine, studi longitudinali di esercizio (4) applicando il modello animale di MS con l'encefalomielite autoimmune sperimentale (EAE). I dati degli studi di intervento che valutano la progressione della malattia mediante misure cliniche (1) non supportano un effetto modificante della malattia dell'esercizio fisico; tuttavia, i dati RM (2), i dati riportati dal paziente (3) ei dati del modello EAE (4) indicano un possibile effetto modificante della malattia dell'esercizio, ma la forza dell'evidenza limita le conclusioni definitive. Si è concluso che alcune evidenze supportano la possibilità di un potenziale modificatore della malattia dell'esercizio (o dell'attività fisica) nei pazienti con SM, ma per confermare ciò sono necessari studi futuri che utilizzano metodologie migliori.

parole chiave: attività della malattia, terapia fisica, attività fisica, allenamento

Introduzione

La sclerosi multipla (SM) è una malattia clinicamente e patologicamente complessa ed eterogenea di eziologia sconosciuta [Kantarci, 2008]. Nei paesi europei 28 con una popolazione totale di 466 milioni di persone, si stima che gli individui 380,000 siano affetti da SM [Sobocki et al. 2007]. La malattia è progressiva ma più del 80% di tutti i pazienti con SM ha la malattia per più di 35 anni [Koch-Henriksen et al. 1998], il numero di anni di vita persi per la malattia da 5 a 10 [Ragonese et al. 2008]. Il fatto che la SM sia una malattia cronica, duratura e invalidante rende la riabilitazione della SM un'importante disciplina nel mantenimento di uno stile di vita indipendente e del livello associato di qualità della vita [Takemasa, 1998]. Nonostante il fatto che i pazienti con SM per molti anni siano stati consigliati di non partecipare all'esercizio fisico perché è stato riportato che porta a peggioramento dei sintomi o dell'affaticamento, è generalmente accettato di consigliare l'esercizio fisico per i pazienti con SM negli ultimi due decenni [Sutherland and Andersen, 2001]. L'esercizio fisico è ben tollerato e induce miglioramenti rilevanti nel funzionamento sia fisico che mentale delle persone con SM [Dalgas et al. 2008]. È una questione aperta se l'esercizio fisico può invertire le menomazioni causate dalla malattia in sé o se l'esercizio si limita a invertire gli effetti causati dall'inattività secondaria alla malattia. Tuttavia, l'esercizio più probabile può invertire gli effetti di uno stile di vita inattivo adottato da molti pazienti [Garner e Widrick, 2003; Kent-Braun et al. 1997; Ng e Kent-Braun, 1997; Stuifbergen, 1997]. Nondimeno, è stato suggerito che l'esercizio fisico potrebbe avere un potenziale impatto sulla progressione della malattia della SM rallentando il processo stesso della malattia [Heesen et al. 2006; Le-Page et al. 1994; Bianco e Castellano, 2008b]. In altri disturbi è stato dimostrato che l'esercizio fisico ha il potenziale di avere un impatto sulla funzione cerebrale e, come recentemente sintetizzato da Motl e colleghi, l'esercizio negli anziani con o senza demenza porta a un miglioramento cognitivo relativo a una condizione di controllo [Motl et al. 2011b]. Sulla base di questo e dei pochi risultati esistenti nei pazienti con sclerosi multipla, Motl e colleghi hanno suggerito che l'esercizio può anche migliorare il funzionamento cognitivo nei pazienti con sclerosi multipla. Tuttavia, nella SM non è stato verificato se l'esercizio fisico abbia un effetto più generale di modifica della malattia.

Per ottenere maggiori informazioni su questo importante argomento, abbiamo quindi condotto una ricerca sistematica della letteratura allo scopo di identificare gli studi che collegano l'esercizio (o l'attività fisica) alla progressione della malattia nei pazienti con sclerosi multipla o nel modello animale di SM dell'encefalomielite autoimmune sperimentale (EAE). Uno scopo secondario della revisione è stato quello di discutere i possibili meccanismi che spiegano questo collegamento se esiste e di discutere le direzioni di studio future in questo campo.

Metodi

La letteratura inclusa è stata identificata attraverso una ricerca bibliografica completa (PubMed, SweMed +, Embase, Cochrane Library, PEDro, SPORTDiscus e ISI Web of Science) che è stata eseguita al fine di identificare gli articoli pertinenti riguardanti la SM e l'esercizio fino a 4 September 2011. La ricerca è stata eseguita utilizzando "esercizio fisico", "allenamento fisico", "allenamento fisico", "allenamento fisico", "allenamento" o "allenamento" in combinazione con "sclerosi multipla" o "encefalomielite autoimmune sperimentale". . Non sono state inserite limitazioni relative all'anno di pubblicazione e all'età dei soggetti. Se possibile, estratti, commenti e capitoli di libri sono stati esclusi quando si esegue la ricerca nei diversi database. Questa ricerca ha prodotto pubblicazioni 547. Uno screening di queste pubblicazioni basate sul titolo e sull'astratto ha rivelato pubblicazioni 133 rilevanti per ulteriori letture. Gli elenchi di riferimento di queste pubblicazioni 133 sono stati controllati per ulteriori pubblicazioni pertinenti che non sono state acquisite dalla ricerca. Ciò ha portato a ulteriori sei pubblicazioni e in un totale di 139 ha letto attentamente le pubblicazioni. Gli studi che si sono rivelati non rilevanti (n = 65), meta-analisi (n = 3), recensioni (n = 22), abstract di conferenza (n = 8) e articoli non scritti in inglese (n = 2) sono stati esclusi da l'analisi finale (vedi Figura 1). Sono stati inclusi studi trasversali e longitudinali rilevanti.

Secondo Goldman e colleghi, le misure pensate per riflettere la progressione della malattia (o attività) nella SM possono essere valutate con misure di esito oggettive o soggettive [Goldman et al. 2010]. Le misure oggettive includono misure di outcome clinico (1) come Expanded Disability Status Scale (EDSS) e Multiple Sclerosis Functional Composite (MSFC) e (2) misure non cliniche come la risonanza magnetica. Le misure soggettive includono (3) misure riferite dal paziente pensate per riflettere la progressione della malattia o la disabilità come la funzione tardiva e l'inventario dell'invalidità. Sono stati inclusi in questa categoria anche gli studi che applicano misure riferite al paziente che includevano una misura dell'attività fisica. Inoltre, abbiamo aggiunto una categoria contenente studi che applicano (4) il modello animale EAE della SM come popolazione di studio. Sulla base di questo quadro, gli articoli localizzati sono stati suddivisi nei seguenti quattro gruppi (vedi Tabella 1):

  1. progressione della malattia valutata con misure di esito clinico (n = 12);
  2. progressione della malattia valutata con misure non cliniche (n = 2);
  3. progressione della malattia valutata con misure riferite dal paziente (n = 10);
  4. progressione della malattia valutata in studi su animali (n = 3).

risultati

Progressione della malattia valutata con misure cliniche

Un certo numero di studi che hanno valutato gli interventi di esercizi strutturati che durano da 3 a 26 settimane hanno incluso scale cliniche che riflettono la progressione della malattia come misura di esito. Le scale cliniche applicate comprendono l'EDSS [Bjarnadottir et al. 2007; Dalgas et al. 2009; Fimland et al. 2010; Golzari et al. 2010; Petajan et al. 1996; Pilutti et al. 2011; Rodgers et al. 1999; Romberg et al. 2004; White et al. 2004], il MSFC [Pilutti et al. 2011; Romberg et al. 2005], il Guys Neurological Disability Scale (GNDS) [Kileff and Ashburn, 2005; van den Berg et al. 2006] e il Functional Independence Measure (FIM) [Romberg et al. 2005]. Gli studi che applicano l'EDSS non hanno generalmente trovato alcun cambiamento dopo l'allenamento di resistenza [Petajan et al. 1996; Pilutti et al. 2011; Rodgers et al. 1999], allenamento di resistenza [Dalgas et al. 2009; Fimland et al. 2010; White et al. 2004] o interventi di allenamento combinati [Bjarnadottir et al. 2007; Romberg et al. 2004]. Solo uno studio di Golzari e colleghi che ha valutato gli effetti delle settimane di allenamento combinato 8 (3 giorni / settimana) ha riportato un miglioramento nel punteggio EDSS [Golzari et al. 2010]. Questo risultato non è stato confermato in uno studio a lungo termine (settimane 26) [Romberg et al. 2005] anche valutando gli effetti della formazione combinata. Nello studio di Romberg e colleghi non sono stati trovati effetti su EDSS e FIM, ma un piccolo effetto positivo è stato riscontrato nella MSFC. Alcuni studi hanno applicato il GNDS riportando un miglioramento dopo settimane di 12 di allenamento bisettimanale di durata [Kileff e Ashburn, 2005] e uno che non riportava alcun effetto di 4 settimane di allenamento di resistenza completato 3 giorni alla settimana [van den Berg et al. 2006].

In sintesi, gli studi di intervento di esercizi strutturati di diverse modalità di allenamento che durano settimane 3-26 non hanno generalmente rilevato effetti sui punteggi dell'EDSS. Alcuni studi sull'esercizio hanno mostrato effetti positivi quando si applicano altre scale cliniche (MSFC e GNDS).

Progressione della malattia valutata con misure non cliniche

Due studi di Prakash e colleghi hanno valutato gli effetti dell'idoneità cardiorespiratoria sulla funzione e struttura del cervello applicando l'MRI (funzionale) [Prakash et al. 2007, 2009]. Uno studio [Prakash et al. 2007] ha studiato l'impatto dell'idoneità cardiorespiratoria sul funzionamento cerebrovascolare dei pazienti con SM. Ventiquattro partecipanti di sesso femminile con SM recidivante-remittente sono stati reclutati per lo studio e tutti i partecipanti hanno superato la valutazione di idoneità (picco VO2) e sono stati sottoposti a scansione in un sistema di risonanza magnetica 3-T durante l'esecuzione del test di addizione seriale testata (PVSAT). Livelli di fitness più elevati sono stati associati a prestazioni più veloci durante il PVSAT che potrebbero essere correlati a un maggiore reclutamento di una regione specifica della corteccia cerebrale (giro frontale inferiore destro [IFG] e giro frontale medio [MFG]) noti per essere reclutati dai pazienti SM durante le prestazioni di PVSAT presumibilmente compensano il deterioramento cognitivo attribuibile alla SM. Al contrario, livelli inferiori di fitness sono stati associati ad attività potenziata nella corteccia cingolata anteriore (ACC), pensata per riflettere la presenza di una maggiore quantità di conflitto aumentando il potenziale di errore nei partecipanti con sclerosi multipla in forma più bassa. Gli autori hanno interpretato i risultati come supporto all'allenamento aerobico come intervento per supportare lo sviluppo di ulteriori risorse corticali nel tentativo di contrastare il declino cognitivo derivante dalla SM. Tra un certo numero di test cognitivi, solo il PASAT (Paced Auditory Addition Test Test) ha mostrato una debole correlazione (p = 0.42) al picco VO2 che porta gli autori a suggerire che il fitness non ha influenza sulle misure del funzionamento cognitivo generale.

In un altro studio di Prakash e colleghi è stata studiata la relazione tra fitness cardiorespiratorio (VO2 max) e misure di atrofia della materia grigia e integrità della sostanza bianca (entrambe associate al processo patologico) [Prakash et al. 2009]. Un approccio basato su voxel all'analisi della materia grigia e della materia bianca è stato applicato sui cervelli del cervello da un sistema di risonanza magnetica 3-T. Più specificatamente è stato esaminato se livelli più elevati di fitness nei pazienti con SM femmina 21 fossero associati con il volume di materia grigia conservato e l'integrità della sostanza bianca. È stata riportata un'associazione positiva tra fitness cardiorespiratorio e volumi di materia grigia regionale e valori di anisotropia frazionaria focale superiore. Sia il volume di materia grigia conservato che l'integrità del tratto di sostanza bianca sono stati associati a prestazioni migliori in termini di velocità di elaborazione. Riconoscendo la natura trasversale dei dati, gli autori hanno suggerito che la forma fisica eserciti un'influenza profilattica sul declino strutturale osservato precocemente, preservando l'integrità neuronale nella SM, riducendo così la disabilità a lungo termine.

In breve, (f) hanno iniziato a emergere studi di risonanza magnetica che suggeriscono un effetto protettivo dell'idoneità cardiorespiratoria sulla funzione e struttura cerebrale nei pazienti con SM. Tuttavia, la natura trasversale dei pochi studi esistenti limita le conclusioni sull'esistenza di una relazione causale.

Progressione della malattia valutata con misure riferite al paziente

Un certo numero di studi ha affrontato la relazione tra esercizio fisico o attività fisica e la progressione della malattia in studi su questionari su larga scala che applicano misure riferite dal paziente.

In un ampio studio longitudinale descrittivo, Stuifbergen e colleghi hanno esaminato le correlazioni tra il cambiamento dei limiti funzionali, i comportamenti degli esercizi e la qualità della vita [Stuifbergen et al. 2006]. Più che i pazienti 600 MS hanno completato un numero di questionari ogni anno per un periodo di anni 5. Le misure longitudinali autodefinite sono state analizzate applicando la modellazione di curve latenti. La scala di stato di incapacità ha fornito una misura dei limiti funzionali dovuti alla SM, mentre il profilo di Lifestyle Health Promoting II ha fornito una misura del comportamento dell'esercizio. Al primo test (test al basale) i dati trasversali hanno mostrato una correlazione negativa significativa (r = -0.34) tra limitazioni funzionali e comportamenti di esercizio, suggerendo che all'inizio dello studio livelli più alti di limitazioni funzionali erano associati a livelli più bassi di esercizio. I dati longitudinali dello studio hanno mostrato che l'aumento dei tassi di variazione dei limiti funzionali era correlato alla diminuzione dei tassi di cambiamento nei comportamenti degli esercizi (r = -0.25). In altre parole, questi risultati suggeriscono che l'aumento dei comportamenti degli esercizi corrisponda a una diminuzione dei tassi di variazione dei limiti funzionali. Non è stata trovata alcuna correlazione tra il grado iniziale di limitazione e il tasso di esercizio continuo che ha portato gli autori a suggerire che le persone con SM con vari livelli di limitazioni potrebbero rallentare la traiettoria di limitazioni crescenti a lungo termine con una partecipazione fisica costante.

Una serie di studi di Motl e colleghi hanno affrontato la relazione tra attività fisica, sintomi, limitazioni funzionali e disabilità nei pazienti con SM. In uno studio trasversale [Motl et al. 2006] in pazienti affetti da 196 MS, sono stati raccolti il ​​numero di sintomi entro 30 giorni (Elenco di controllo dei sintomi relativo alla SM) e attività fisica (Questionario dell'esercizio di Godin Leisure-Time e dati dell'accelerometro 7-day). Dopo la modellazione dei dati è stata trovata una relazione diretta tra i sintomi e l'attività fisica (r = -0.24) che indica che un numero maggiore di sintomi ha prodotto una minore quantità di attività fisica. Tuttavia, gli autori hanno notato che il disegno della sezione trasversale preclude le inferenze sulla direzione della causalità, e l'attività fisica potrebbe influenzare i sintomi in quanto i sintomi influenzano la partecipazione all'attività fisica. Quando è stata modellata in questo modo è stata trovata una correlazione inversa moderata tra attività fisica e sintomi (r = -0.42) che indica un minor numero di sintomi quando il livello di attività fisica è alto. Ciò ha portato gli autori a suggerire l'esistenza di una relazione bidirezionale tra attività fisica e sintomi.

In un seguente studio del questionario Motl e colleghi hanno esaminato l'attività fisica (Questionario dell'esercizio di Godin Leisure-Time e dati dell'accelerometro del giorno 7) e i sintomi (Sintomo inventario e lista dei sintomi correlati a MS) come correlazione di limitazioni funzionali e disabilità (funzione tardiva e disabilità Inventario) nei pazienti con 133 MS [Motl et al. 2007, 2008b]. Un modello basato sul modello di disabilità proposto da Nagi (1976) è stato testato come modello primario e questo ha dimostrato che l'attività fisica ei sintomi erano negativamente correlati (r = -0.59) e quelli che erano più fisicamente attivi avevano una funzione migliore (r = 0.4 ). Inoltre, quelli con una funzione migliore avevano meno disabilità (r = 0.63) che hanno portato gli autori a concludere che i risultati indicano che l'attività fisica è associata a ridotta disabilità (attraverso un'associazione con la funzione) compatibile con il modello di disabilità di Nagi (Nagi 1976), ma ancora una volta il progetto trasversale ha limitato conclusioni definitive sulla direzione delle relazioni.

Motl e colleghi hanno quindi pubblicato uno studio longitudinale (case report) che esamina la relazione tra il peggioramento dei sintomi e il livello di attività fisica nel corso di un periodo da 3 a 5 [Motl et al. 2008a]. Lo studio ha mostrato che il peggioramento dei sintomi (intervista) era significativamente associato a livelli più bassi di attività fisica auto-riferita (International Physical Activity Questionnaire [IPAQ]) in un gruppo di soggetti 51 con SM. Lo studio supporta i sintomi come possibile spiegazione del tasso di inattività fisica tra i pazienti con SM, ma la direzione della relazione causa-effetto non può ancora essere stabilita. Sulla base dei risultati gli autori suggeriscono che la gestione dei sintomi potrebbe essere importante per la promozione dell'attività fisica, ma anche che i sintomi possono essere sia un antecedente che una conseguenza dell'attività fisica.

Successivamente Motl e colleghi hanno pubblicato uno studio trasversale che esamina la correlazione tra attività fisica e compromissione neurologica e disabilità in un gruppo di pazienti con 80 MS [Motl et al. 2008c]. È stata misurata l'attività fisica (giorno dell'accelerometro 7-day), menomazione e disabilità (inventario sintomo e EDSS auto-segnalato) e sono state trovate correlazioni significative tra l'attività fisica e sia EDSS (r = -0.60) che Sintomo inventario (r = -0.56) . Gli autori hanno concluso che l'attività fisica era associata a ridotta compromissione neurologica e disabilità, ma ha anche affermato che non è possibile stabilire alcuna relazione causale a causa della natura trasversale dello studio.

Motl e McAuley hanno quindi pubblicato uno studio longitudinale su larga scala che esamina i cambiamenti nell'attività fisica (Godin Leisure-Time Exercise Questionnaire e dati dell'accelerometro 7-day) e sintomi (Symptom Inventory e MS-related Symptom Checklist) come correlazione di cambiamenti funzionali limitazioni e disabilità (funzione Late-Life e inventario delle invalidità) [Motl e McAuley, 2009]. Un totale di pazienti con 292 MS sono stati seguiti per i mesi 6. Anche in questo caso un modello basato sul modello di disabilitazione proposto da Nagi (1976) è stato testato come modello primario e questo ha dimostrato che il cambiamento nell'attività fisica era associato a una variazione residua della funzione (r = 0.22) e il cambiamento di funzione era associato a cambiamenti residui in disabilità (r = 0.20). Ciò ha portato gli autori a concludere che i risultati indicano che il cambiamento nell'attività fisica è associato al cambiamento della disabilità (attraverso un'associazione con la funzione) compatibile con il modello di disabilità di Nagi, ma altri modelli possono essere applicati durante l'analisi e un'interpretazione causale, quindi, ancora non potrebbe essere adottato.

In uno studio longitudinale di 6 al mese Motl e colleghi hanno quindi testato l'ipotesi che un cambiamento nell'attività fisica (Questionario Esercizio di Godin-Tempo libero e Questionario internazionale di attività fisica) fosse inversamente associato a un cambiamento nell'handicap (Sclerosi multipla a piedi - 12 ) in pazienti con SM recidivante-remittente [Motl et al. 2011a]. I dati dei pazienti con 263 MS sono stati analizzati utilizzando l'analisi lineare del pannello e la modellizzazione della covarianza. I risultati hanno mostrato che un cambiamento di unità di deviazione standard di 1 nell'attività fisica era associato a una variazione residua dell'unità di deviazione standard di 0.16 nell'indebolimento della deambulazione. Questi risultati, quindi, supportano l'attività fisica come un approccio importante, quando si cerca di evitare menomazioni della deambulazione.

Infine, Motl e McAuley hanno pubblicato un documento sui dati longitudinali (6 mesi) dai pazienti 292 MS valutando la relazione tra un cambiamento nell'attività fisica (dati dell'accelerometro 7-day) e il cambiamento nella progressione della disabilità (scala dei livelli della malattia determinata dal paziente) [Motl e McAuley, 2011]. L'analisi del pannello ha mostrato che un cambiamento nell'attività fisica era associato a un cambiamento nella progressione della disabilità (coefficiente di percorso: -0.09). Ciò ha portato gli autori a concludere che una riduzione dell'attività fisica è un correlato comportamentale (ma non necessariamente una causa) di progressione della disabilità a breve termine in persone con SM.

Recentemente, Tallner e colleghi hanno valutato la relazione tra l'attività sportiva (Baecke Questionnaire - indice sportivo) e le recidive della SM durante gli ultimi anni 2 (basati su self-report) in pazienti affetti da SM tedesco 632 [Tallner et al. 2011]. I pazienti sono stati divisi in quattro gruppi in base al loro indice sportivo. Lo studio non ha mostrato differenze globali tra i quattro gruppi riguardo al numero di recidive negli ultimi 2 anni. Tuttavia, il gruppo più attivo aveva la media più bassa e la deviazione standard di tutti i gruppi. Di conseguenza, questi dati suggeriscono che l'esercizio non influenza negativamente il tasso di recidiva ei dati indicano inoltre che l'esercizio riduce effettivamente il tasso di recidiva.

In sintesi, le misure riferite dal paziente sull'associazione tra esercizio fisico o attività fisica e progressione della malattia (espressa come sintomi, limitazioni funzionali o disabilità) o attività (tasso di recidiva) forniscono evidenza di un'associazione con più attività fisica che fornisce protezione. Tuttavia, a causa della natura degli studi, la causalità di questa associazione non è stata stabilita.

Progressione della malattia valutata in studi sugli animali

Alcune evidenti difficoltà metodologiche esistono nella progettazione di uno studio umano che chiarisce se l'esercizio ha o meno un impatto sulla progressione della malattia nei pazienti con SM. Pertanto, la domanda è stata affrontata nel modello animale MS degli EAE.

In uno studio preliminare di Le-Page e colleghi sono stati seguiti quattro gruppi di ratti EAE dal giorno 1 al giorno 10 dopo l'iniezione con un agente che induce EAE [Le-Page et al. 1994]. L'iniezione ha dato luogo a tre diversi corsi patologici nei ratti, in particolare acuto (i ratti hanno sviluppato rapidamente segni clinici seri e sono morti senza segni di recupero), monofasico (i ratti hanno sviluppato solo un attacco di malattia seguito da un completo recupero) e recidiva cronica (CR-EAE più di un attacco di malattia seguito da remissione). Il decorso della malattia CR-EAE è caratterizzato dallo sviluppo di un attacco paralitico acuto iniziale 10-20 giorni dopo l'immunizzazione con neuroantigeni e lo sviluppo di recidive spontanee in seguito. Una femmina e un gruppo maschile di ratti si esercitavano e un gruppo femminile e maschile fungeva da controllo. L'esercizio consisteva nel correre su un tapis roulant dal giorno 1 al giorno 10 dopo l'iniezione. Il protocollo è stato progressivamente regolato con la durata crescente da 60 min verso 120 min e la velocità di marcia crescente da 15 a 30 m / min. Lo studio ha dimostrato che nei ratti esercitati da CR-EAE di entrambi i sessi l'insorgenza della malattia è stata significativamente ritardata rispetto all'inizio dei ratti CR-EAE di controllo. Inoltre, la durata della prima recidiva è risultata significativamente ridotta nei ratti sottoposti a CR-EAE rispetto ai ratti di controllo, mentre non è stato osservato alcun effetto sulla gravità del picco della malattia. Non sono stati osservati effetti dell'attività fisica nei ratti EAE acuta e monofasica. Gli autori hanno concluso che l'esercizio di resistenza durante la fase di induzione dell'EAE ha ridotto leggermente un tipo di EAE (CR-EAE) ma anche che l'esercizio non ha esacerbato la malattia.

In uno studio complementare Le-Page e colleghi hanno condotto ulteriori quattro esperimenti nel modello monofasico di EAE [Le-Page et al. 1996]. Esperimenti 1 e 2 hanno dimostrato che 2 giorni consecutivi di esercizio intensivo (250-300 min / day) eseguiti subito dopo l'iniezione ha avuto un effetto di riduzione sul decorso dei segni clinici di malattia rispetto ai ratti di controllo. Inoltre, l'inizio della malattia e il giorno della massima severità sono stati entrambi ritardati nei ratti in esercizio, mentre non è stata osservata alcuna variazione nella durata della malattia. Quando sono stati eseguiti gli 2 giorni consecutivi di esercizio prima dell'iniezione, non sono stati osservati effetti. Negli esperimenti 3 e 4 è stato testato come 5 giorni di esercizio più moderato a velocità costante (15-25 m / min per 2 ore) o velocità variabile (3 min a 2 m / min e poi 2 min a 35 m / min per un totale di 1 ore) ha influenzato il decorso della malattia e i parametri clinici. Non sono stati osservati effetti sul decorso della malattia e sui parametri clinici. Gli autori hanno concluso che un esercizio severo contrario all'esercizio più moderato ha leggermente influenzato la fase effettrice dell'EA monofasica e ha confermato che l'esercizio fisico eseguito prima dell'esordio dell'EAE non ha esacerbato i segni clinici.

Più recentemente, Rossi e colleghi hanno ulteriormente esplorato gli effetti dell'attività fisica sulla progressione della malattia nel modello di topi CR-EAE [Rossi et al. 2009]. In questo studio un gruppo di topi aveva la sua gabbia dotata di una ruota motrice nel giorno dell'immunizzazione, mentre il gruppo di controllo non aveva alcuna ruota funzionante. La quantità di attività fisica non era controllata ed era quindi la quantità di attività fisica volontaria nella ruota in esecuzione che costituiva l'intervento. In un ulteriore esperimento i topi EAE in gabbie standard sono stati confrontati con topi EAE in gabbie dotate di una ruota bloccata. Ciò è stato fatto per analizzare il ruolo dell'attività fisica da quello dell'arricchimento sensoriale causato dalla ruota stessa, e ha mostrato di non influenzare il decorso clinico della malattia. Durante la fase iniziale (13 giorni dopo l'iniezione) della malattia, i topi hanno eseguito spontaneamente una media di 760 gira / giorno nella ruota in esecuzione che è scesa a 18 gira / giorno quando il deficit motorio ha raggiunto il picco (20-25 giorni dopo l'iniezione). Lo studio ha dimostrato che la gravità dei disturbi clinici indotti da EAE era attenuata in entrambe le fasi acuta e cronica dell'EAE nei topi fisicamente attivi, che mostravano costantemente deficit neurologici meno severi rispetto agli animali EAE di controllo durante un periodo di 50 giorni dopo l'induzione EAE . Inoltre, è stato dimostrato che sia i difetti sinaptici che quelli dendritici causati dall'EAE sono stati attenuati dall'attività fisica.

In sintesi, l'esercizio aerobico (o attività fisica volontaria) ha il potenziale per influenzare il decorso clinico della malattia nel modello animale di SM negli EAE.

Dr Jimenez White Coat
Partecipare alle attività fisiche e all'esercizio fisico può essere utile per chiunque, specialmente per le persone con sclerosi multipla o SM. L'esercizio fisico può aiutare ad alleviare i sintomi della sclerosi multipla, tuttavia i pazienti devono prestare attenzione alla quantità di attività fisica in cui si impegnano. Diversi studi come quello discusso in questo articolo hanno determinato che le attività fisiche e gli esercizi possono aiutare a migliorare i sintomi e anche a rallentare giù la progressione della sclerosi multipla. È essenziale parlare con un operatore sanitario per discutere i dettagli di ciascun programma di allenamento al fine di ottenere il meglio dal benefici dell'esercizio della SM. Dr. Alex Jimenez DC, CCST

Discussione

Recenti prove provenienti da studi che applicano misure non cliniche e riferite dal paziente, nonché da studi che applicano il modello animale di EAE, indicano un possibile effetto modificante l'attività fisica (o attività fisica), ma la forza dell'evidenza limita le conclusioni definitive. Inoltre, questi risultati non sono confermati negli studi di intervento che valutano la progressione della malattia mediante misure di outcome clinico. Nonostante le ovvie difficoltà associate, in questo campo sono necessari futuri studi di intervento a lungo termine in un ampio gruppo di pazienti con SM.

Progressione della malattia della SM

Alcuni importanti problemi metodologici sorgono quando si tenta di misurare la progressione della malattia della SM. La misura ideale di esito per la SM dovrebbe quantificare la progressione irreversibile della malattia, ma nella SM questo si è dimostrato difficile. L'espressione pleiotropica della SM rende difficile misurare tutti gli aspetti della malattia e potrebbe essere necessario concentrarsi su sintomi specifici. Inoltre, la grande eterogeneità del paziente, la variabilità della popolazione nel decorso della malattia e il tempo di progressione, le variazioni subcliniche della RM di impatto incerto sulla progressione ritardata della disabilità, i deficit neurologici sfaccettati con varie abilità per i singoli pazienti per compensare e le comorbidità del paziente complicano ulteriormente le cose [Goldman et al. 2010].

Misure di outcome clinico

EDSS, MSFC e tasso di recidiva sono le misure standard di outcome clinico per gli studi terapeutici sulla SM e la misura più utilizzata per la progressione della malattia è l'EDSS [Goldman et al. 2010]. La nostra revisione della letteratura mostra che gli studi sull'esercizio (resistenza, resistenza e allenamento combinato) che applicano l'EDSS in genere non riportano alcun cambiamento dopo un intervento di esercizio. Negli studi medici che applicano l'EDSS, sono di norma richieste ampie dimensioni del campione e interventi della durata di 2-3 per misurare i cambiamenti nei tassi di esacerbazione tra il trattamento e il placebo [Bates, 2011]. Ciò corrisponde male ai brevi periodi di intervento (3-26 settimane) e alle piccole dimensioni del campione applicate nella maggior parte degli studi di esercizio. Ciò è dovuto alla bassa sensibilità globale e alla sensibilità al cambiamento dell'EDSS come riportato in numerosi studi (per riferimenti vedi Goldman et al. [2010]). Inoltre, l'EDSS è stato criticato per il suo ridimensionamento nonintervista, l'enfasi sullo stato di ambulazione e l'assenza di componenti cognitivi e visivi adeguati [Balcer, 2001]. Nonostante l'enfasi posta sull'ambulacro e che una recente meta-analisi abbia concluso che gli impatti degli esercizi camminando positivamente [Snook e Motl, 2009], non sono stati osservati cambiamenti nell'EDSS nella maggior parte degli studi esaminati, indicando una reattività su scala ridotta verso gli interventi di esercizio. Negli studi clinici la MSFC è ritenuta più sensibile ai cambiamenti rispetto all'EDSS [Goldman et al. 2010]. Questo suggerimento è supportato dal risultato di uno studio di esercizi che applica sia l'EDSS che il MSFC. In questo studio a lungo termine (settimane 26) [Romberg et al. 2005] sono stati valutati gli effetti della formazione combinata su EDSS e MSFC. Solo la MSFC ha mostrato un effetto significativo che ha portato gli autori a concludere che la MSFC era più sensibile rispetto all'EDSS nel rilevamento del miglioramento della compromissione funzionale a seguito dell'esercizio combinato. Nei futuri studi sull'esercizio della valutazione della progressione della malattia, si dovrebbe quindi considerare di aggiungere la MSFC come misura di esito clinico.

Oltre alla reattività su scala ridotta, si possono ipotizzare interventi a breve termine e campioni di dimensioni ridotte altre spiegazioni per la generale mancanza di effetti sulle misure di outcome clinico. Nonostante non vi sia un chiaro schema nei dati esistenti, il tipo di esercizio (ad esempio allenamento di resistenza contro resistenza) può influenzare l'effetto catturato dalle scale cliniche. Inoltre, la maggior parte degli studi ha valutato pazienti con SM lieve o moderato (EDSS <6). Forse le scale cliniche sarebbero più sensibili ai cambiamenti nei pazienti con disabilità più gravi. Infine, i risultati possono essere distorti se in genere si tratta di pazienti più fisicamente idonei che accettano di essere arruolati in studi di esercizio. In tal caso, il livello di fitness di base potrebbe essere superiore alla media in questi pazienti, riducendo ulteriormente la possibilità di un cambiamento nelle scale cliniche con bassa reattività.

Solo alcuni studi [Bjarnadottir et al. 2007; Petajan et al. 1996; Romberg et al. 2004; White et al. 2004] presenta dati chiari sulla percentuale di recidive, ma a causa dei brevi periodi di intervento e delle piccole dimensioni del campione nella maggior parte degli studi, le variazioni nella percentuale di recidive non dovrebbero essere evidenti. Tuttavia, Romberg e colleghi hanno trovato un totale di recidive di 11 (cinque nel gruppo di allenamento combinato e sei nel gruppo di controllo) durante un periodo di intervento di 6-mese [Romberg et al. 2004]. Allo stesso modo, Petajan e colleghi (gruppo di allenamento di resistenza quattro recidive e gruppo di controllo tre recidive) [Petajan et al. 1996] e Bjarnadottir e colleghi (gruppo di allenamento combinato una recidiva e gruppo di controllo una recidiva) [Bjarnadottir et al. 2007] ha riportato tassi di recidiva identici in gruppi di controllo e di esercizio. Nello studio di White e colleghi, nessun partecipante ha manifestato recidive durante l'intervento di 8-settimana valutando l'allenamento di resistenza [White et al. 2004]. Recentemente, Tallner e colleghi hanno raccolto questionari self-report su tassi di recidiva e attività fisica da pazienti con SM per esaminare la relazione tra i diversi livelli di attività sportiva e le ricadute [Tallner et al. 2011]. Sulla base di questi dati gli autori hanno concluso che l'esercizio non ha avuto un'influenza significativa sull'attività clinica della malattia. Presi insieme i pochi dati esistenti non indicano che qualsiasi tipo di esercizio aumenti il ​​tasso di recidiva tra i pazienti con SM. Tuttavia, questi dati devono essere interpretati con cautela a causa del numero limitato di partecipanti (non stratificati in base al tipo o alla gravità della malattia) e dei brevi periodi di intervento nella maggior parte degli studi. Di conseguenza, i futuri studi a lungo termine con un numero elevato di partecipanti dovrebbero pertanto includere il tasso di recidiva come misura di esito.

Misure non cliniche

L'applicazione della risonanza magnetica ha rivoluzionato la diagnosi e la gestione dei pazienti con SM [Bar-Zohar et al. 2008]. Per quanto riguarda gli studi clinici, la risonanza magnetica offre numerosi vantaggi rispetto alle misure di outcome clinico accettate per la SM, tra cui una maggiore sensibilità all'attività della malattia e una migliore associazione con i risultati di istopatologia. Inoltre, la risonanza magnetica fornisce misure altamente riproducibili su scale ordinali e la valutazione della RM può essere eseguita con il massimo grado di abbagliamento [Bar-Zohar et al. 2008]. Di conseguenza, una misurazione RM sostitutiva riflette la progressione della malattia come l'attività della lesione (lesioni potenziate da gadolinio e lesioni T2-iperintense nuove o ingrandite) o la gravità della malattia (volume totale della lesione iperintensa T2, volume totale della lesione T1-hypointense e atrofia cerebrale totale) [Bermel et al. 2008] può ridurre le dimensioni richieste del campione necessarie per valutare considerevolmente gli effetti della terapia di esercizio sulla progressione della malattia. Fino ad ora solo due studi trasversali hanno valutato gli effetti dell'esercizio (espresso come l'attuale livello di fitness cardiorespiratorio) su diverse misure di risonanza magnetica limitando le conclusioni che possono essere tratte da questo tipo di studio. Tuttavia, i risultati promettenti incoraggiano l'inclusione della risonanza magnetica come misura di esito, in studi sperimentali longitudinali che valutano gli effetti dell'esercizio sulla progressione della malattia.

Misure riferite dal paziente

Le misure riferite dai pazienti relative all'associazione tra esercizio fisico o attività fisica e progressione della malattia (espresse come sintomi, limitazioni funzionali o disabilità) forniscono evidenza di un'associazione con più attività fisica che fornisce protezione. Tuttavia, la natura degli studi non consente conclusioni sulla causalità di questa associazione. Nel gruppo di studi che applicava misure riferite al paziente, abbiamo deciso di includere non solo misure di esercizio, ma anche misure di attività fisica. Si riconosce che una misura dell'attività fisica non è necessariamente una misura surrogata dell'esercitazione, ma i molti risultati interessanti, in particolare del gruppo di Motl e colleghi, hanno causato questo. In un recente articolo, basato sui propri studi, Motl e colleghi concludono che recenti ricerche hanno identificato l'attività fisica come correlazione comportamentale della disabilità nella SM. Ciò ha suggerito agli autori che l'attività fisica potrebbe attenuare la progressione di ciò che chiamano "disabilità motoria" migliorando la funzione fisiologica nelle persone con SM, in particolare coloro che hanno raggiunto un punto di riferimento di disabilità irreversibile (EDSS> 4) [Motl, 2010] . Potrebbe essere più conveniente offrire ai pazienti con SM più disabili (EDSS> 4) la terapia di esercizio, ma è necessario notare che la maggior parte degli studi sull'esercizio fisico non indica che esiste una relazione tra il grado di adattamento dell'addestramento e la disabilità neurologica. Infatti, gli studi indicano che i pazienti con SM con un punteggio EDSS inferiore a 4.5 sperimentano i maggiori miglioramenti dopo un periodo di allenamento di resistenza rispetto a pazienti con SM più disabile [Ponichtera-Mulcare et al. 1997; Schapiro et al. 1988] o che non esistono differenze [Petajan et al. 1996]. Va notato che nessuno di questi studi è stato utilizzato per valutare gli effetti dell'attività fisica nei pazienti con SM con diversi livelli di disabilità. Tuttavia, un recente studio di Filipi e colleghi ha valutato in modo specifico se i mesi di allenamento di resistenza 6 migliorano la resistenza nei pazienti con SM con diversi livelli di disabilità (EDSS 1-8) e hanno concluso che tutti gli individui con SM, nonostante diversi livelli di disabilità, hanno mostrato un miglioramento parallelo forza muscolare [Filipi et al. 2011]. Ciò porta a suggerire che l'esercizio può essere ugualmente importante durante le prime fasi della malattia, anche per quanto riguarda l'impatto sulla progressione della malattia.

Un importante vantaggio nell'applicare le misure riportate dai pazienti è l'opportunità di raccogliere dati da campioni di grandi dimensioni in studi longitudinali. Inoltre, sembra importante raccogliere dati sulla prospettiva del paziente quando si valutano gli effetti dell'esercizio sulla progressione della malattia. Gli studi futuri, comprese le misure riportate dai pazienti, dovrebbero includere anche misure di esito clinico e / o non clinico, se possibile.

Studi sugli animali

La nostra revisione ha mostrato che l'esercizio aerobico (o attività) ha il potenziale per influenzare il decorso clinico della malattia nel modello animale di EAE. L'ovvia domanda è se i risultati del modello animale di SM degli EAE possano essere estrapolati all'uomo. Al momento non è possibile dare una risposta chiara a questa domanda. Una recente revisione ha riassunto se gli attuali trattamenti modificanti la malattia sono giustificati sulla base dei risultati degli studi EAE. Qui si è concluso che sebbene l'EAE sia certamente uno specchio imperfetto della SM, molti reperti clinici, immunopatologici e istologici sono riprodotti in modo impressionante da modelli animali, rendendo l'EAE inestimabile nel chiarire i meccanismi immunopatologici di base della SM e fornire un terreno di prova per nuove terapie [Farooqi et al. 2010]. Di conseguenza, un trasferimento diretto di risultati in soggetti umani non può essere fatto, ma la verifica di ipotesi difficili può iniziare qui. Inoltre, va notato che nell'EAE non è possibile controllare l'intensità di esercizio relativa poiché non è possibile eseguire un test di esercizio massimale (come un test VO2 max). Di conseguenza l'intensità di esercizio relativa applicata può variare tra gli animali. Questo è anche il motivo per cui è molto difficile valutare gli effetti dell'esercizio aerobico sulla capacità aerobica nell'EAE. Tuttavia, il modello EAE offre una serie di vantaggi rispetto agli studi sull'uomo. Inoltre, costi inferiori, controllo facile con l'aderenza all'intervento e fattori ambientali e genetici controllati, il modello EAE consente anche la valutazione di possibili meccanismi localizzati nel sistema nervoso centrale (SNC), che dovrebbero essere oggetto di attenzione in studi futuri. Un'altra revisione ha affermato che l'eterogeneità genetica, che è così critica nella popolazione di SM, si riflette solo quando più modelli diversi di EAE sono studiati in parallelo [Gold et al. 2006]. Questo aspetto dovrebbe anche essere incorporato in studi futuri.

Possibili meccanismi

Diversi meccanismi sono stati proposti come possibile collegamento tra esercizio fisico e stato patologico nella SM. Alcuni dei candidati più promettenti includono citochine e fattori neurotrofici [Bianco e Castellano, 2008a].

Citochine. Le citochine svolgono un ruolo importante nella patogenesi della sclerosi multipla e rappresentano un importante bersaglio per gli interventi di trattamento. In particolare, l'interleuchina (IL) -6, l'interferone (IFN) -γ e il fattore di necrosi tumorale (TNF) -α hanno un ruolo prominente nel processo di demielinizzazione e danno assonale sperimentato da persone con SM [Compston and Coles, 2008].

Le variazioni delle concentrazioni di alcune citochine, in particolare IFN-γ e TNF-α, sono state associate a variazioni dello stato della malattia nella SM e a concentrazioni elevate di citochine pro-infiammatorie Th-1 (come TNF-α, IFN-γ , IL-2 e IL-12) possono contribuire alla neurodegenerazione e alla disabilità [Ozenci et al. 2002]. Ciò ha portato a suggerire che l'esercizio fisico può contrastare gli squilibri tra le citochine pro-infiammatorie Th1 e le citochine anti-infiammatorie Th2 (come IL-4 e IL-10) migliorando i meccanismi anti-infiammatori, e quindi potenzialmente in grado di alterare l'attività della malattia nei pazienti con SM [Bianco e Castellano, 2008b].

Nella SM sia gli effetti acuti e / o cronici della resistenza [White et al. 2006], resistenza [Castellano et al. 2008; Heesen et al. 2003; Schulz et al. 2004] e allenamento combinato [Golzari et al. 2010] su diverse citochine sono state valutate. Uno studio di White e colleghi ha riportato che livelli di riposo di IL-4, IL-10, proteina C-reattiva (CRP) e IFN-γ sono stati ridotti, mentre i livelli di TNF-α, IL-2 e IL-6 sono rimasti invariati dopo 8 settimane di allenamento di resistenza bisettimanale [White et al. 2006]. Questi risultati suggeriscono che un allenamento di resistenza progressivo può avere un impatto sulle concentrazioni di citochine a riposo e, quindi, potrebbe avere un impatto sulla funzione immunitaria generale e sul decorso della malattia in individui con SM. Tuttavia, lo studio non è stato controllato e solo i partecipanti 10 sono stati inclusi, ovviamente, limitando la forza delle prove. Heesen e colleghi hanno valutato gli effetti acuti di 8 settimane di allenamento di resistenza su IFN-γ, TNF-α e IL-10 e hanno confrontato questo sia con un gruppo di controllo MS di lista di attesa che con un gruppo di soggetti sani abbinati [Heesen et al. 2003]. Dopo aver completato 30 minuti di allenamento di resistenza (in bicicletta), un aumento dell'IFN-γ è stato indotto in modo simile in tutti i gruppi mentre le tendenze verso aumenti minori di TNF-α e IL-10 sono state osservate nei due gruppi di pazienti con SM. Sulla base di questi dati gli autori hanno concluso che non è possibile dimostrare alcuna deviazione nella risposta immunitaria pro-infiammatoria allo stress fisico nei pazienti con SM. Questi risultati, quindi, sostengono che un singolo attacco di allenamento di resistenza può influenzare il profilo delle citochine almeno per un periodo di tempo nei pazienti con SM. In un'altra pubblicazione dello stesso studio, Schulz e colleghi non sono stati in grado di dimostrare alcuna differenza tra il livello di riposo o la risposta acuta di IL-6 dopo 30 minuti di esercizio di resistenza nel gruppo di allenamento della SM (8 settimane di ciclismo) e il gruppo di controllo della SM [Schulz et al. 2004].

Uno studio di Castellano e colleghi ha valutato gli effetti delle settimane di allenamento di resistenza 8 (ciclismo, 3 giorni / settimana) su IL-6, TNF-α e IFN-γ nei pazienti 11 MS e controlli sani abbinati 11. Nei pazienti con sclerosi laterale sia l'IFN-γ che il TNF-α a riposo erano elevati dopo l'allenamento di resistenza, mentre non sono stati osservati cambiamenti nei controlli sani [Castellano et al. 2008]. Come nello studio di Heesen e colleghi [Heesen et al. 2003], Castellano e colleghi hanno anche studiato gli effetti acuti di una singola sessione di allenamento di resistenza e allo stesso modo non hanno riscontrato differenze rispetto ai controlli sani, ma in questo studio non sono stati osservati aumenti di IFN-γ e TNF-α in nessuno dei gruppi contrastanti i risultati di Heesen e colleghi.

Nello studio più recente, Golzari e colleghi hanno eseguito uno studio randomizzato controllato (RCT) che valuta gli effetti delle settimane 8 di allenamento combinato di resistenza e resistenza su IFN-γ, IL-4 e IL-17 [Golzari et al. 2010]. Lo studio ha mostrato riduzioni significative nelle concentrazioni a riposo di IFN-γ e IL-17 nel gruppo di esercizi, mentre non sono stati osservati cambiamenti nel gruppo di controllo, ma non sono stati effettuati confronti di gruppo.

In sintesi, non è possibile vedere un modello chiaro nelle risposte citochine riportate all'esercizio probabilmente riflettendo ampie differenze metodologiche tra gli studi (tipo di studio, tipo di intervento dell'esercizio, tempo di misurazione, standardizzazione, ecc.) E un basso potere statistico che è fondamentale a causa della grande variazione in questo tipo di misurazioni. Tuttavia, è stato riportato che un singolo attacco di esercizio influenza un numero di citochine (pro-infiammatorie) nei pazienti con sclerosi multipla e sono stati riportati anche cambiamenti cronici nella concentrazione a riposo di diverse citochine dopo un periodo di allenamento. Inoltre, la risposta sembra essere paragonabile a quella dei soggetti sani. Le citochine, quindi, possono collegare l'esercizio e la progressione della malattia nella SM, ma i futuri RCT su larga scala devono valutarlo ulteriormente.

Fattori neurotrofici. I fattori neurotrofici sono una famiglia di proteine ​​che si ritiene abbiano un ruolo nella prevenzione della morte neurale e nel favorire il processo di recupero, la rigenerazione neurale e la rimielinizzazione per tutta la vita [Ebadi et al. 1997]. Alcuni dei fattori neurotrofici più ben caratterizzati includono il fattore neurotrofico derivato dal cervello (BDNF) e il fattore di crescita nervoso (NGF) [Bianco e Castellano, 2008b].

Gold e colleghi hanno valutato gli effetti acuti di un singolo esercizio (30 min ciclico a 60% VO2 max) su NGF e BDNF nei pazienti 25 MS e hanno confrontato questo con un gruppo di controlli sani abbinati [Gold et al. 2003]. Lo studio ha mostrato che le concentrazioni basali di NGF erano significativamente più elevate nei pazienti con SM rispetto ai controlli. Trenta minuti dopo l'esercizio è stato osservato un aumento significativo nel BDNF mentre è stata osservata una tendenza verso un aumento di NGF. Tuttavia, le modifiche non differiscono da quelle osservate nei soggetti sani. Ciò ha portato gli autori a concludere che l'esercizio moderato può essere utilizzato per indurre la produzione di neutrophin in soggetti con SM mediando eventualmente gli effetti benefici dell'esercizio fisico. In uno studio dello stesso gruppo, Schulz e colleghi hanno valutato gli effetti del ciclo bisettimanale in bici per le settimane 8 su BDNF e NGF in un RCT in pazienti con SM [Schulz et al. 2004]. Lo studio non ha mostrato effetti sulla concentrazione a riposo e sulla risposta all'esercizio acuto dopo il periodo di intervento e solo una tendenza verso livelli di NGF a riposo più bassi è stata trovata. Castellano e White hanno anche valutato se le 8 settimane di ciclismo (tre volte alla settimana), influenzerebbero le concentrazioni sieriche di BDNF nei pazienti con sclerosi multipla e nei controlli sani [Castellano and White, 2008]. In contrasto con i risultati di Gold e colleghi, il BDNF a riposo era inferiore al basale nei pazienti con sclerosi multipla rispetto ai controlli, ma nessuna differenza (una tendenza) tra i gruppi è stata trovata dopo 8 settimane. Nei pazienti con sclerosi multipla la concentrazione di BDNF a riposo era significativamente elevata tra le settimane 0 e 4 e poi tendeva a diminuire tra le settimane 4 e 8, mentre la concentrazione di BDNF rimanente era rimasta invariata nelle settimane di allenamento 4 e 8 nei controlli. Inoltre, è stata valutata la risposta a una singola sessione di esercizio mostrando una significativa riduzione di BDNF 2 e 3 ore dopo l'esercizio in entrambi i gruppi di nuovo in contrasto con i risultati di Gold e colleghi. Gli autori hanno concluso che i loro risultati hanno fornito prove preliminari che dimostrano che l'esercizio fisico può influenzare la regolazione del BDNF nell'uomo.

In sintesi i risultati contrastanti sugli effetti dell'attività fisica sui fattori neurotrofici sono presenti nei pazienti con sclerosi multipla, rendendo necessari ulteriori studi. Tuttavia, i risultati implicano che l'esercizio fisico può influenzare diversi fattori neurotrofici noti per essere coinvolti nei processi neuroprotettivi.

Conclusioni

Non si può affermare chiaramente se l'esercizio ha un effetto modificante la malattia o meno nei pazienti con SM, ma studi che lo indicano esistono. Sono quindi necessari futuri studi di intervento a lungo termine in un ampio gruppo di pazienti affetti da SM per affrontare questa importante questione.

Ringraziamenti

Gli autori desiderano ringraziare il bibliotecario Edith Clausen per un contributo sostanziale alla ricerca bibliografica completa.

Le note

Questa ricerca non ha ricevuto alcuna sovvenzione specifica da alcuna agenzia di finanziamento nei settori pubblico, commerciale o non profit.

UD ha ricevuto sovvenzioni di viaggio e / o onorari da Biogen Idec, Merck Serono e Sanofi Aventis. ES ha ricevuto sostegno alla ricerca e borse di viaggio da Biogen Idec, Merck Serono e Bayer Schering e borse di viaggio da Sanofi Aventis.

La sclerosi multipla, o SM, è una malattia cronica identificata dai sintomi di dolore, affaticamento, perdita della vista e coordinazione compromessa causata dal danneggiamento delle guaine mieliniche delle cellule nervose nel sistema nervoso centrale, o CNS. È stato dimostrato che l'esercizio fisico aiuta a migliorare la gestione dei sintomi della sclerosi multipla e riduce la progressione della malattia, sebbene siano ancora necessarie ulteriori prove, l'articolo sopra riassume queste misure di esito. Lo scopo dell'articolo sopra dimostra come l'esercizio fisico può cambiare la progressione della sclerosi multipla e migliorare la salute e il benessere generale. Lo scopo delle nostre informazioni è limitato ai problemi di salute chiropratica e spinale. Per discutere l'argomento, non esitate a chiedere al Dr. Jimenez o contattaci a 915-850-0900 .

A cura di Dr. Alex Jimenez

Riferito da: Ncbi.nlm.nih.gov/pmc/articles/PMC3302199/

Pulsante Green Call Now H .png

Discussione aggiuntiva sull'argomento: mal di schiena acuto

Mal di schiena è una delle più diffuse cause di disabilità e giorni persi al lavoro in tutto il mondo. Il dolore alla schiena è il secondo motivo più comune per le visite di un medico, superate solo dalle infezioni delle alte vie respiratorie. Circa il 80 percento della popolazione subirà un dolore alla schiena almeno una volta nella vita. La colonna vertebrale è una struttura complessa composta da ossa, articolazioni, legamenti e muscoli, tra gli altri tessuti molli. Lesioni e / o condizioni aggravate, come dischi erniciati, può eventualmente portare a sintomi di mal di schiena. Le lesioni sportive o gli incidenti automobilistici sono spesso la causa più frequente di mal di schiena, tuttavia a volte il più semplice dei movimenti può avere risultati dolorosi. Fortunatamente, le opzioni di trattamento alternative, come la cura chiropratica, possono aiutare ad alleviare il mal di schiena attraverso l'uso di aggiustamenti spinali e manipolazioni manuali, in definitiva migliorando il sollievo dal dolore.

foto di blog del fumetto carta ragazzo

EXTRA EXTRA | ARGOMENTO IMPORTANTE: consigliato El Paso, TX Chiropractor

***

Benefici dell&#39;esercizio per la sclerosi multipla

Benefici dell'esercizio per la sclerosi multipla

Sei alle prese con i tuoi sintomi di SM su base regolare? Sclerosi multipla, o SM, è una malattia in cui il sistema immunitario del corpo umano attacca il rivestimento grasso della mielina che circonda e isola le cellule nervose, un processo chiamato demielinizzazione. I sintomi comuni della sclerosi multipla comprendono affaticamento, spasmi muscolari, problemi di deambulazione, sensazioni di formicolio e intorpidimento.

Secondo diversi studi di ricerca, il miglioramento della forza, della flessibilità e della mobilità dalla partecipazione ad attività fisiche ed esercizi aiuta a ridurre il rischio di fratture ossee e altri disturbi nelle persone con SM. Uno studio indica anche che un'alimentazione scorretta e una mancanza di attività fisica ed esercizio fisico sono i fattori di rischio più frequenti per le persone con sclerosi multipla.

Un altro studio di ricerca sui benefici dell'esercizio per la sclerosi multipla è stato stampato da ricercatori dell'Università dello Utah in 1996. I partecipanti allo studio di ricerca hanno sviluppato una mentalità più positiva, aumentato la loro forza, flessibilità e mobilità, hanno sperimentato meno fatica, hanno migliorato la funzionalità dell'intestino, della vescica e cardiovascolare e sviluppato meno sintomi di depressione.

Esercizi per la sclerosi multipla

Un programma di fitness dovrebbe essere progettato sotto la supervisione di un medico e può essere regolato al variare dei sintomi della SM. I pazienti con SM dovrebbero impegnarsi in attività fisiche ed esercizi più volte alla settimana ed evitare allenamenti per lunghi periodi di tempo. I pazienti con SM possono ancora svolgere compiti in casa. Esempi di attività quotidiane includono cucina, giardinaggio e altre attività domestiche.

Gli esercizi che possono aiutare a gestire i sintomi della SM includono:

  • Yoga. Questo tipo di attività fisica / attività fisica diventa consapevole della respirazione per rilassare il corpo e la mente. I benefici dello yoga includono il miglioramento dell'allineamento del corpo umano, migliorando il proprio equilibrio. Lo yoga ti insegna anche tecniche di rilassamento, come la meditazione, che puoi usare durante la risonanza magnetica, la risonanza magnetica o l'iniezione.
  • Tai Chi. Questa arte marziale cinese ti insegna come respirare, rilassare e rallentare i tuoi movimenti. Inoltre, il Tai Chi può anche aiutare a migliorare l'equilibrio, aiutando ulteriormente a gestire e supportare il tono muscolare, oltre ad alleviare lo stress.
  • Esercizi d'acqua Le attività / esercizi fisici eseguiti in acqua richiedono meno sforzo. Questo aiuta le persone con SM a muoversi in modi che altrimenti non sarebbero in grado di svolgere correttamente. I benefici degli esercizi in acqua includono il rilassamento muscolare, una maggiore flessibilità, un miglior movimento, una maggiore resistenza e una riduzione del dolore. Questi si concentrano sul miglioramento della resistenza aerobica.

Il professionista sanitario raccomandava che le persone con SM evitassero completamente l'esercizio per paura di aggravare i loro sintomi. Ora, le prove indicano che l'esercizio fisico regolare non solo migliora la qualità della vita delle persone con SM, ma potrebbe anche aiutare ad alleviare i sintomi e diminuire il rischio di complicanze in futuro. L'esercizio fisico può essere utile per chiunque, anche per le persone con sclerosi multipla.

Dr Jimenez White Coat
Secondo molti operatori sanitari, l'attività fisica e l'esercizio fisico sono uno degli elementi più essenziali del trattamento della sclerosi multipla o della sclerosi multipla. Mentre molti pazienti con SM spesso evitano l'esercizio fisico, pensando che aggraveranno i loro sintomi, studi di ricerca hanno dimostrato che l'esercizio fisico può effettivamente aiutare a migliorare i sintomi. Come descritto nel seguente articolo, l'attività fisica può aiutare a migliorare forza, mobilità e flessibilità. Inoltre, l'attività fisica può avere vari altri benefici per la salute della SM, tra cui una migliore funzionalità dell'intestino e della vescica, nonché un miglioramento dell'umore e una riduzione dell'affaticamento. Dr. Alex Jimenez DC, CCST Insight

Iniziare con l'esercizio per la SM

Kathleen Costello, infermiera professionista e vicepresidente associato di assistenza medica per la National Multiple Sclerosis Society, raccomanda di chiedere il supporto di un operatore sanitario, come un chiropratico o un fisioterapista, per determinare quali attività fisiche o esercizi sarebbero vantaggiose per i pazienti con SIGNORINA. I benefici dell'esercizio per la sclerosi multipla includono:

Meno affaticamento

Vari tipi di attività fisiche e di esercizio fisico possono migliorare la fatica. Questa è una lamentela frequente tra le persone con SM. Uno studio di ricerca sullo yoga per le persone con SM ha scoperto che lo yoga è superiore rispetto ad altri tipi di esercizio per ridurre l'affaticamento. Un altro studio ha scoperto che otto mesi di esercizio in acqua hanno ridotto la fatica e migliorato la qualità della vita nelle donne con SM.

Mood migliore

Esercizi di intensità moderata, come camminare a ritmo sostenuto, danzare o andare in bicicletta, sono stati dimostrati in diversi studi di ricerca per migliorare l'umore nelle persone depresse. Uno studio ha scoperto che i benefici si applicano anche agli adulti con disturbi neurologici, inclusa la sclerosi multipla, specialmente quando sono soddisfatte le linee guida sull'attività fisica. Il Centers for Disease Control and Prevention raccomanda attualmente agli adulti di ottenere almeno 150 minuti, o 2 ore e 30 minuti, di attività fisiche o esercizi di moderata intensità ogni settimana, oltre a includere almeno due routine di allenamento che prevedono esercizi di potenziamento muscolare per la SM .

Migliore controllo della vescica

Tra gli studi di ricerca sui benefici dell'esercizio in persone con SM, una recensione ha rilevato che i mesi di esercizio aerobico 15 hanno contribuito a migliorare la funzionalità dell'intestino e della vescica nelle persone con SM. Un piccolo studio di ricerca pilota pubblicato sul Journal of Alternative and Complementary Medicine di 2014 ha scoperto che un programma di yoga permetteva anche un migliore controllo della vescica tra le persone con SM.

Ossa più forti

Le attività fisiche e l'esercizio fisico, come camminare, correre o usare una macchina ellittica, possono aiutare a rafforzare le ossa e possono proteggere dall'osteoporosi, una malattia che assottiglia le ossa che aumenta la possibilità di frattura delle ossa. Molte persone con SM o sclerosi multipla sono a rischio di sviluppare osteoporosi a causa di una combinazione di fattori, tra cui:

  • Bassi livelli ematici di vitamina D, l'integratore alimentare che funziona con il calcio per proteggere la salute delle ossa
  • Una storia di assunzione di corticosteroidi, farmaci usati per trattare razzi di MS che possono portare a bassi livelli di calcio nel sangue
  • Difficoltà di mobilità, che potrebbero rendere una persona meno incline a impegnarsi in diverse forme di esercizio
  • Basso peso corporeo

Allo stesso tempo, le persone con SM hanno occasionalmente condizioni di equilibrio che le rendono più vulnerabili alla caduta, una causa significativa delle ossa rotte. Trovare un mezzo per prendere parte ad esercizi e attività fisiche che possono aiutare a rafforzare le ossa è quindi importante per preservare la densità ossea e aiutare a prevenire le fratture, specialmente nelle persone con diagnosi di SM.

Peso di gestione

Se i sintomi della SM comportano una riduzione dell'attività fisica o dell'esercizio fisico, una delle conseguenze può includere l'aumento di peso, che può rendere ancora più difficile l'aggiramento. L'uso di corticosteroidi può anche portare ad un aumento di peso. Il coinvolgimento in attività fisiche o l'esercizio fisico può aiutare a rallentare o fermare l'aumento di peso. L'esercizio fisico regolare può giovare anche alle persone sottopeso. Insieme ad altri benefici sopra descritti, l'attività fisica o l'esercizio fisico possono anche aumentare l'appetito nelle persone sottopeso.

Per molte persone, la SM significa cambiamenti nelle attività fisiche o negli esercizi che possono svolgere e in che modo saranno in grado di eseguirli, tuttavia, ciò non implica che il loro stile di vita si fermerà. Collabora con il tuo medico per scoprire le azioni più adatte e i dispositivi di assistenza che potrebbero aiutarti a muoverti con la SM. Lo scopo delle nostre informazioni è limitato ai problemi di salute chiropratica e spinale. Per discutere l'argomento, non esitate a chiedere al Dr. Jimenez o contattaci a 915-850-0900 .

A cura di Dr. Alex JimenezR

Pulsante Green Call Now H .png

Discussione aggiuntiva sull'argomento: mal di schiena acuto

Mal di schiena è una delle più diffuse cause di disabilità e giorni persi al lavoro in tutto il mondo. Il dolore alla schiena è il secondo motivo più comune per le visite di un medico, superate solo dalle infezioni delle alte vie respiratorie. Circa il 80 percento della popolazione subirà un dolore alla schiena almeno una volta nella vita. La colonna vertebrale è una struttura complessa composta da ossa, articolazioni, legamenti e muscoli, tra gli altri tessuti molli. Lesioni e / o condizioni aggravate, come dischi erniciati, può eventualmente portare a sintomi di mal di schiena. Le lesioni sportive o gli incidenti automobilistici sono spesso la causa più frequente di mal di schiena, tuttavia a volte il più semplice dei movimenti può avere risultati dolorosi. Fortunatamente, le opzioni di trattamento alternative, come la cura chiropratica, possono aiutare ad alleviare il mal di schiena attraverso l'uso di aggiustamenti spinali e manipolazioni manuali, in definitiva migliorando il sollievo dal dolore.

foto di blog del fumetto carta ragazzo

EXTRA EXTRA | ARGOMENTO IMPORTANTE: consigliato El Paso, TX Chiropractor

***

Esercizio nella sclerosi multipla: una componente integrale della gestione delle malattie

Esercizio nella sclerosi multipla: una componente integrale della gestione delle malattie

Partecipare a regolari attività fisiche ed esercizi è essenziale per mantenere la salute e il benessere generale, tuttavia, per circa 400,000 persone negli Stati Uniti che vivono con sclerosi multipla, l'esercizio può avere diversi benefici che vale la pena conoscere. Gli operatori sanitari raccomandavano che i pazienti con sclerosi multipla, o SM, evitassero di impegnarsi in attività fisiche ed esercizi per prevenire l'aggravamento dei sintomi. Tuttavia, studi di ricerca suggeriscono che l'esercizio fisico può migliorare la qualità della vita delle persone con sclerosi multipla. Lo scopo di questo articolo è dimostrare gli effetti dell'esercizio fisico nella SM.

astratto

La sclerosi multipla (SM) è la più comune malattia infiammatoria cronica del sistema nervoso centrale (SNC) nei giovani adulti. La malattia causa una vasta gamma di sintomi a seconda della localizzazione e delle caratteristiche della patologia del SNC. Oltre al trattamento immunomodulatorio basato sulla droga, sia gli approcci basati sulla droga che quelli non farmacologici sono stabiliti come strategie complementari per alleviare i sintomi esistenti e per prevenire le malattie secondarie. In particolare, la terapia fisica come esercizio fisico e fisioterapia può essere personalizzata in base alle esigenze del singolo paziente e ha il potenziale per migliorare l'esito individuale. Tuttavia, i dati sistematici di alta qualità sulla terapia fisica nella SM sono rari. Questo articolo riassume le attuali conoscenze sull'influenza dell'attività fisica e l'esercizio fisico sui sintomi correlati alla malattia e le restrizioni fisiche nei pazienti con SM. Altre strategie di trattamento come trattamenti farmacologici o addestramento cognitivo sono state deliberatamente escluse ai fini di questo articolo.

parole chiave: Sclerosi multipla, Fisioterapia, Esercizio fisico, Prevenzione delle sequele, Trattamento personalizzato

Sfondo della SM

La SM è una malattia infiammatoria cronica del SNC che causa demielinizzazione multifocale insieme a gliosi astrocitica e perdita di assoni variabile nel cervello e nella colonna vertebrale. La SM è una delle cause più comuni di disabilità non traumatica nei giovani adulti e circa 1-2.5 milioni di persone in tutto il mondo sono stimati a seconda della pubblicazione [1,2]. Le donne hanno maggiori probabilità di sviluppare la malattia rispetto agli uomini (rapporto femmina: maschio di circa 2-3: 1). La SM di solito si manifesta tra l'età di 20 e 40 anni, raramente molto prima durante l'infanzia o in età avanzata. Il decorso della malattia è in genere recidivante-remittente con progressione in una forma progressiva secondaria dopo un periodo di tempo variabile o progressivo primario sin dall'inizio. L'eziologia precisa della SM non è ancora chiara. Una combinazione di fattori ambientali e genetici che portano a reazioni autoimmuni contro strutture del SNC che a loro volta provocano danni al sistema nervoso centrale e danno neurologico è considerata il più probabile patomeccanismo [2,3].

A seconda della localizzazione e delle caratteristiche dei cambiamenti morfologici nella materia cerebrale sia bianca che grigia, possono manifestarsi sintomi e segni diversi, come disabilità visiva, disartria e disfagia, spasticità, paresi, compromissione della coordinazione e dell'equilibrio, atassia, dolore, deficit sensoriali, vescica, intestino e disfunzione sessuale [3-7]. Anche affaticamento, cambiamenti emotivi e cognitivi sono spesso presenti nella SM [8-13]. Questi sintomi, spesso in combinazione con una mancanza di fiducia nelle proprie capacità e capacità di gestire i sintomi, portano a una ridotta capacità funzionale e successivamente a una ridotta attività fisica e sportiva, nonché a una ridotta qualità della vita [14-18]. Come in altre condizioni a ridotta mobilità, nella SM la mancanza di attività fisica può portare a sequele secondarie come obesità, osteoporosi e / o danno cardiovascolare che a loro volta rappresentano una seria minaccia per i pazienti poiché aumentano il rischio di ulteriori complicazioni come la trombosi , embolia polmonare, infezioni del tratto respiratorio superiore o del tratto urinario o ulcere decubitali prominenti [15,16,19].

Secondo l'eziopatologia autoimmune, i farmaci immunomodulatori come l'interferone-β o il glatiramer acetato sono il trattamento di scelta. Se questi farmaci non sono sufficientemente efficaci, può essere necessaria una terapia di escalation con sostanze immunosoppressive (mitoxantrone), anticorpi monoclonali (natalizu-mab) o il modulatore recettoriale del recettore sphingosinfosfato fingolimod (Figura 1) [20-22].

definizioni

Ai fini di questo articolo verranno utilizzati i termini movimento, attività fisica, esercizio fisico, funzione fisica, terapia fisica, fisioterapia e sport secondo le seguenti definizioni (Tabelle 1 e 2): In termini di sistema motorio, il termine "movimento" "Include un cambiamento attivo o passivo indotto nella posizione del corpo. L'esercizio fisico regolare e l'attività fisica sono fattori decisivi per la qualità della vita di una persona migliorando in modo sostenibile la salute, il benessere e la prevenzione delle malattie in tutte le fasi della vita. Al contrario dello sport, in cui l'attenzione si concentra sul successo fisico, sulla competizione e sul divertimento, l'attività fisica comprende qualsiasi tipo di movimento fisico, che consuma energia, indipendentemente dalla motivazione sottostante. Il termine "attività fisica che migliora la salute" comprende sia le attività del tempo libero (ad esempio lo sport) che le attività quotidiane (ad esempio salire le scale). L'intensità dell'attività è categorizzata in base all'equivalente metabolico (MET; 1 MET corrisponde all'assorbimento di ossigeno di un adulto stando seduti = 3.5 ml (uomini) e 3.2 ml (donne) O2 / kg / min) in luce (<3 MET), moderato (3-6 MET) e vigoroso (> 6 MET). In contrasto con l'attività fisica generale, l'esercizio comprende l'esecuzione pianificata di movimenti sistematicamente ripetuti per realizzare abilità, mantenere e rafforzare la condizione fisica e migliorare le prestazioni. L'atletica leggera, in particolare, mira a migliorare la flessibilità generale e include l'allenamento di resistenza per mantenere le prestazioni per periodi di tempo più lunghi ad un livello elevato e allenamento della forza per aumentare la forza muscolare. I termini resistenza e allenamento aerobico, nonché resistenza e allenamento della forza, sono spesso usati come sinonimi. La funzione fisica comprende "una serie di passi sempre più integrati, con il livello più alto costituito dalle attività più avanzate della vita quotidiana (ADL), il compimento dei ruoli sociali e il perseguimento di attività ricreative" [16]. Il termine "fisioterapia" include abilità manuali, che sono opportunamente integrate da rimedi come acqua, calore, luce o elettricità e mira a ripristinare la funzionalità e la percezione cosciente del corpo umano. I programmi di allenamento attivo e / o passivo fanno parte dei metodi fisioterapici. Al contrario, la "terapia fisica" è piuttosto usata come termine generico, comprendente diversi tipi di attività fisica come esercizio fisico, allenamento (funzionale), fisioterapia e riabilitazione.

Trattamento sintomatico della SM: mirare a una modifica personalizzata dei sintomi e dei risultati

Gli approcci di trattamento sintomatico basati sulla droga e non sulla droga per la SM si completano a vicenda. Gli approcci basati sulla droga che sono citati nelle revisioni complete [21,22] vanno oltre lo scopo di questo articolo. Oltre alla consulenza e all'assistenza infermieristica, le strategie non farmacologiche comprendono la fisioterapia, la fisioterapia, la logopedica, la terapia occupazionale che include sussidi per la vita e la mobilità, socioterapia e psicoterapia (figura 1). Queste misure possono essere applicate in modo multimodale, il che significa che diversi approcci sono combinati nella strategia di trattamento del paziente e dovrebbero generalmente integrare la terapia farmacologica [4,23,24]. Le terapie fisiche sono sviluppate in base ai singoli sintomi e influenzano positivamente diversi fattori allo stesso tempo. È importante sottolineare che, oltre a ridurre i sintomi, migliorare la mobilità, migliorare la qualità della vita e conferire il massimo dell'indipendenza possibile, ad esempio attraverso l'allenamento funzionale delle ADL, come lavare, mangiare, bere, vestirsi e svolgere le faccende domestiche, le terapie sintomatiche possono prevenire malattie secondarie potenzialmente letali [15,25]. Le terapie fisiche possono essere applicate in quasi tutti gli stadi della malattia - dal primo esordio dei sintomi a pazienti altamente compromessi e condizioni palliative. In contrasto con la fisioterapia, l'esercizio fisico non fa parte delle terapie comunemente usate offerte ai pazienti con SM; tuttavia, potrebbe essere uno strumento promettente ed economico per migliorare varie funzioni nei pazienti con SM.

Esercizio in pazienti con SM: effetti sui parametri clinici (tabella 3)

La compromissione dei pazienti con SM come la spasticità o la paresi è principalmente una conseguenza del progresso della malattia (cambiamenti morfologici), ma può essere aggravata dalla ridotta attività fisica [14,26]. È stato dimostrato che l'esercizio migliora vari aspetti del profilo fisiologico dei pazienti con SM; in particolare, la compromissione dell'inattività può essere alleviata dall'esercizio [26]. Tuttavia, le raccomandazioni sull'esercizio fisico per i pazienti con SM devono affrontare una serie di limitazioni: sebbene esista un gran numero di studi su cui sono basate le raccomandazioni, molti di questi studi presentano limitazioni, tra cui piccole dimensioni del campione, mancanza di un gruppo di controllo appropriato , disegno inedito e incapacità di distinguere tra diversi corsi e fasi della malattia. Infatti, solo occasionalmente viene applicato un disegno di studio randomizzato controllato e in cieco. I regimi di allenamento spesso non sono standardizzati e gli interventi non sono sufficientemente descritti. La comparabilità degli studi è inoltre limitata da una durata variabile del trattamento che si estende su un breve periodo di settimane fino a pochi mesi, diversa frequenza di trattamento e intensità di trattamento diversa. Gli effetti a lungo termine dei rispettivi interventi sono raramente riportati [14,27-31]. Inoltre, gli effetti dell'attività fisica sono stati studiati quasi esclusivamente in pazienti con SM con lieve o moderata compromissione (punteggio sulla scala di disabilità estesa (EDSS) inferiore a 7) [14]. A nostra conoscenza, solo uno studio pubblicato di recente ha esaminato pazienti con SM altamente compromessa con un EDSS di 5-8 [32].

In sintesi, nonostante la qualità metodologica spesso insufficiente degli studi e dei regimi di allenamento non sufficientemente descritti [14,29,33] la maggior parte di questi studi include programmi di resistenza (es. Esercizio di resistenza progressiva, meccanica di deambulazione), resistenza (ad es. Ergometria della bicicletta, braccio o braccia- ergometria delle gambe, esercizio acquatico, tapis roulant a piedi) e formazione combinata hanno fornito prove per un beneficio dell'esercizio nei pazienti con sclerosi multipla [14,15,28,29]. Questi programmi di allenamento sono indicati più dettagliatamente in seguito. Tutti i programmi di allenamento sono stati ben tollerati dai pazienti. Quasi il 100% dei partecipanti al ricovero e i partecipanti 59-96% degli studi domiciliari sono stati completati senza il verificarsi di eventi avversi [34-38].

Allenamento di resistenza

Un moderato allenamento di resistenza ha portato a un miglioramento della forza muscolare sia degli arti inferiori che degli arti superiori e alcune misure funzionali come la velocità della camminata, l'affaticamento e la qualità della vita [14,15,17,28,29,31,34]. Alcuni autori hanno riportato effetti benefici nel trasferimento della sedia [14,39], nell'andatura, nel salire le scale e nella prova cronometrata e in uscita (alzandosi da una sedia, camminando 3 m, girandosi e sedendosi di nuovo) [14,35,40]. Ma, come descritto sopra, sono stati trovati risultati diversi e contraddittori. Ad esempio, alcuni autori hanno riportato miglioramenti marcati nella capacità aerobica, misurati dal massimo consumo di ossigeno (VO2-max), [14,41,42], mentre altri non hanno osservato miglioramenti significativi [14,43,44].

Lo stesso vale per l'affaticamento in quanto vi sono alcune prove per un miglioramento della fatica da parte dell'allenamento di resistenza [30,35,45], mentre altri studi hanno mancato il livello di significatività statistica [14,28,35] o non hanno rivelato alcuna differenza [27,46,47].

Sono stati riportati dati contraddittori su vari aspetti della qualità della vita relativi alla salute come vitalità [14,48], funzionamento sociale [14,44,48], umore [14,42,44], energia [14,42], rabbia [14,41], funzione sessuale [14], vescica e intestino funzione [41] e depressione [14,41].

Un gruppo ha analizzato l'effetto di un programma di allenamento aerobico ambulatoriale di 6 per mesi in pazienti affetti da SM con disabilità da lieve a moderata (EDSS 1-6) e ha osservato una tendenza a maggiori benefici nelle persone con disabilità più gravi rispetto ai pazienti meno affetti, ma lo studio è limitato da la piccola dimensione del campione di pazienti 19 di cui solo i pazienti 11 hanno completato lo studio [42]. Pertanto, questi risultati devono essere gestiti con cura e sono necessari ulteriori studi.

Allenamento di resistenza

L'allenamento di resistenza è noto per migliorare la forza muscolare nelle persone sane. Nei pazienti con sclerosi multipla c'è anche evidenza di miglioramento della forza muscolare [35,40]. Inoltre, nei pazienti con sclerosi multipla sono stati descritti effetti benefici su velocità di camminata, resistenza a passo, arrampicata su scale, prove cronometrate e in partenza, disabilità auto-riferita e affaticamento auto-segnalato, oltre a miglioramenti significativi nei disturbi dell'andatura, misurati dall'indice di andatura dinamica [35,49].

Esistono diverse forme di allenamento di resistenza. Una forma, per esempio, costituisce un esercizio di resistenza progressiva (PRE), che secondo Taylor et al. comprende i seguenti tre principi: "1. eseguire un piccolo numero di ripetizioni con carichi relativamente alti fino al raggiungimento dell'affaticamento muscolare, 2. consentire un riposo sufficiente tra l'esercizio per il recupero e 3. aumentare il carico come capacità di generare sviluppo della forza muscolare "[40].

Cakit et al. ha esaminato l'effetto di PRE mediante l'allenamento ciclico della resistenza progressiva e il rafforzamento degli arti inferiori, entrambi combinati con l'esercizio di equilibrio in uno studio prospettico randomizzato controllato di pazienti con 45 MS [35]. Dopo 8 settimane, i pazienti dei due gruppi di allenamento hanno ottenuto risultati migliori rispetto al test di camminata di 10 m, alla durata dell'esercizio e al test cronometrato e al test di partenza rispetto ai pazienti del gruppo di controllo che non hanno ricevuto alcun intervento. Inoltre, i gruppi di allenamento hanno mostrato prove di effetti superiori su equilibrio, stanchezza, depressione e paura di cadere.

Taylor et al. ha studiato l'effetto di un programma PRE della settimana 10 sulla massima forza muscolare, la resistenza muscolare, l'attività funzionale e la funzione psicologica complessiva nei pazienti con SM [40]. Gli autori hanno riportato miglioramenti significativi della forza delle braccia, della resistenza alle gambe e della velocità di camminata veloce, e una tendenza al miglioramento nel walk-test 2-min e nella vita quotidiana.

Oltre a PRE, vengono utilizzate altre forme di allenamento come le strategie per promuovere la corretta meccanica dell'andatura, concentrandosi su carico, spostamento del peso e posizionamento del corpo, o sollevamento pesi [49]. Ad esempio, Pilutti et al. esaminato l'effetto dell'esercizio di resistenza in sei pazienti gravemente disabili (EDSS 5-8) con SM progressiva (cinque pazienti con progressiva primaria, un paziente con decorso progressivo secondario) mediante un corso di 12 settimana di allenamento su tapis roulant supportato dal peso corporeo tre volte alla settimana per 30 min [32]. I pazienti sono migliorati in termini di velocità di formazione del tapis roulant e del supporto del peso corporeo, nonché nelle sottoscale fisiche e mentali di un questionario sulla qualità della vita. La fatica non è stata ridotta.

Allenamento combinato di resistenza e resistenza

Solo pochi autori hanno esaminato l'effetto della resistenza combinata e dell'allenamento di resistenza nella SM. Sono stati descritti piccoli miglioramenti sia nella forza muscolare che nella velocità dell'andatura [14,34,50]. È interessante notare che, in uno studio relativamente ampio sui pazienti con 95 MS, Surakka et al. ha osservato effetti significativi dell'allenamento dopo sei mesi di allenamento combinato di resistenza e resistenza solo nelle donne, ma non negli uomini, il che potrebbe essere spiegato da un'attività di 25% più alta nelle donne [50]. Inoltre, Romberg et al. hanno riportato miglioramenti significativi nella velocità di camminata e nella resistenza degli arti superiori dopo sei mesi di allenamento combinato, mentre la forza degli arti inferiori, VO2-max, equilibrio statico e destrezza manuale non sono migliorate [34].

In 2005, la Cochrane Collaboration ha pubblicato una prima revisione sistematica sugli effetti dell'attività fisica sull'ADL e sulla qualità della vita correlata alla salute (HRQoL) e sugli effetti della terapia fisica su vari sintomi nei pazienti con SM [33]. Sono stati inclusi solo studi clinici controllati e randomizzati su pazienti adulti affetti da sclerosi multipla che non presentavano una riacutizzazione in quel momento. Sei studi, di cui quattro finora sono stati pubblicati solo come abstract, hanno analizzato gli effetti della terapia fisica (riabilitazione, fisioterapia, esercizio fisico, allenamento funzionale, allenamento indipendente a casa, esercizio acquatico) su diverse variabili correlate alla malattia rispetto ad un gruppo di controllo che non ha ricevuto alcuna terapia fisica [36,39,41,51-53]. Altri tre studi hanno confrontato i risultati di due diversi programmi di terapia fisica. In sintesi, forza muscolare, movimento (cambiamento e mantenimento della postura, camminare, muoversi, trasferimento temporizzato, cadenza di marcia) e test di tolleranza all'esercizio (test di esercizio graduato modificato, VO2-max e indice di costo fisiologico) hanno mostrato un miglioramento sostanziale. I parametri dell'umore (paura, depressione) hanno mostrato solo un moderato miglioramento e l'EDSS, la fatica, i parametri cognitivi e l'ADL sono rimasti invariati [18,37,48].

Asano et al. valutato la qualità metodologica di studi randomizzati controllati selezionati (RCT) di interventi di esercizio nella SM effettuati da 1950 a 2007 [29]. Hanno trovato prove di effetti positivi dell'esercizio sul funzionamento fisico e psicosociale e sulla qualità della vita, ma hanno evidenziato un grande bisogno di RCT di alta qualità in questo campo.

Esercizio in pazienti con SM: l'impatto della temperatura corporea sulla disabilità

In 1890, l'oftalmologo tedesco Wilhelm Uhthoff (1853-1927) ha descritto per la prima volta la disabilità visiva e la paresi che si verificano dopo l'attività fisica. Poiché la temperatura corporea dei pazienti non è stata registrata, Uhthoff ha supposto che i sintomi descritti fossero causati dall'attività fisica stessa e non dall'aumentata temperatura corporea risultante. Di conseguenza, i pazienti con SM sono stati avvisati di non impegnarsi in un esercizio [14-16,19,46,54,55]. Infatti, il 60-80% dei pazienti con SM manifesta una (ri) occorrenza o un peggioramento reversibile dei sintomi neurologici in situazioni con aumento della temperatura corporea, ad esempio durante un'attività fisica vigorosa, febbre o un bagno caldo [14-16,46,54,55]. Come riferimento alla prima descrizione, è stato coniato l'eponimo "fenomeno di Uhthoff". Si ritiene che la causa sottostante sia una disregolazione della temperatura dovuta a disautonomia con conseguente compromissione della velocità di conduzione della velocità di conduzione degli assoni parzialmente demielinizzati [15,16,54,56]. Non fino a circa 1937, numerose indagini sistematiche hanno rivelato la correlazione tra aumento della temperatura corporea e peggioramento della disabilità.

Un altro argomento per cui i pazienti affetti da sclerosi multipla potevano evitare di fare esercizio fisico era il presupposto che uno "spreco" di energia potesse aggravare l'affaticamento e ridurre le ADL [14] che tuttavia non è mai stato confermato. Inoltre, un effetto dannoso dell'attività fisica stessa sulle strutture del SNC o un aumento mediato dall'attività del tasso di recidiva non è mai stato dimostrato [15,57].

Esercizio in pazienti con SM: effetti sul sistema immunitario

È noto che l'esercizio fisico può influenzare la suscettibilità alle comuni malattie infettive come le infezioni del tratto respiratorio superiore in diverse direzioni [58]. Mentre un'attività fisica intensa come lo sport agonistico può portare ad una maggiore suscettibilità alle infezioni, un esercizio moderato può contribuire alla loro prevenzione [15,19,57-59].

A livello delle cellule immunitarie, è stato dimostrato che il ceppo fisico nei soggetti sani aumenta inizialmente la conta dei linfociti periferici che successivamente scende al di sotto del livello iniziale dopo la cessazione dell'attività fisica [19,60,61]. La riduzione dei linfociti risultante è stata di breve durata con una durata massima di 3-24 h [19,58,60] e ha mostrato di essere più prominente nelle cellule Th1 rispetto alle cellule Th2 [61-63]. Poiché le cellule Th1 secernono principalmente citochine proinfiammatorie come IFN-γ, IL-2 e TNF-α mentre Th2 piuttosto secernono citochine anti-infiammatorie come IL-4, IL-5 e IL-10, l'esercizio può promuovere un passaggio da un pro-infiammatorio mediato da Th1 a un ambiente di citochina mediata da Th2 piuttosto anti-infiammatorio [58,60] che è di particolare interesse perché uno squilibrio di cellule Th1 e Th2 è considerato rilevante nella patogenesi della SM [62].

Poiché i farmaci immunomodulatori stabiliti come IFN-β o glatiramer acetato esercitano effetti simili sul sistema immunitario, il trattamento farmacologico e l'attività fisica possono completarsi a vicenda in termini di modulazione del sistema immunitario. Gli unici effetti di breve durata dell'esercizio a livello di cellule immunitarie sostengono intervalli regolari e frequenti di allenamento.

L'effetto dell'esercizio sulla produzione e risposta di citochine è meno chiaro e spesso contraddittorio [44,60,62,64], che può in parte essere spiegato da diverse popolazioni studiate, diversi protocolli di allenamento e / o diversi parametri di lettura e paradigmi. Ad esempio, Heesen et al. ha trovato concentrazioni sieriche di riposo simili di IFN-γ, TNF-α e IL-10 in pazienti con SM allenati e non allenati [62], mentre White et al. hanno riportato ridotte concentrazioni plasmatiche di riposo di IL-4, IL-10, proteina C-reattiva (CRP) e IFN-γ e una tendenza alla riduzione del TNF-a nei pazienti con sclerosi multipla dopo otto settimane di PRE. Si pensa che le contrazioni muscolari stimolino la secrezione di IL-6 [44,65]. Allo stesso modo, sono stati pubblicati dati contraddittori sull'effetto dell'esercizio sull'IL-6 immunoregolatorio nei pazienti con SM [44,64].

Data la componente neurodegenerativa della SM, l'effetto dell'attività fisica, in particolare dell'esercizio sui fattori di crescita dei nervi, è di particolare importanza. Nei roditori è stato dimostrato che l'esercizio stimola il rilascio del fattore neurotrofico derivato dal cervello (BDNF) [66], il fattore di crescita insulino-simile 1 (IGF-1) [67-69] e il fattore di crescita vascolare endoteliale (VEGF) [70 ], che supportano la proliferazione cellulare, la plasticità sinaptica, la neuroprotezione e la neurogenesi in condizioni sia fisiologiche che neuroinfiammatorie [67,71-74]. Anche negli esseri umani l'esercizio sembra modificare la secrezione delle proteine ​​neuroattive [14,67]. In entrambi i partecipanti sani e nei pazienti con SM, 30 min dell'esercizio moderato basato sull'ergometria ha aumentato le concentrazioni di BDNF e del fattore di crescita nervoso (NGF) [59,75]. Aumento delle concentrazioni di BDNF dell'ippocampo sono state misurate su un esercizio moderato [67]. Poiché l'ippocampo è coinvolto in modo cruciale nelle attività di apprendimento e memoria e nella modulazione dell'umore, queste scoperte potrebbero collegare l'esercizio con il rallentamento del deterioramento cognitivo e la stabilizzazione degli affetti nei pazienti con SM [67]. Una maggiore secrezione di IGF-1 è stata finora dimostrata in persone sane dopo l'esercizio [76-78]. IGF-1 come fattore importante nello sviluppo supporta la sopravvivenza cellulare, la crescita del cervello e la mielinizzazione del SNC. Durante le fasi successive della vita IGF-1 potrebbe giocare un ruolo nella neuroprotezione e plasticità sinaptica e cognitiva [67]. Inoltre, l'esercizio fisico ha aumentato l'attività degli enzimi antiossidanti, che potrebbero supportare il ruolo dell'esercizio nella neuroprotezione [67].

Esercizio in pazienti con SM: effetti su morfologia e risultati di imaging

L'attivazione ripetitiva dei programmi motori rafforza gli engram corticali e provoca processi neuroplastici e adattivi come l'attivazione migliorata delle unità motorie e la sincronizzazione dei tassi di attivazione. Al contrario, i periodi di inattività sono associati a effetti opposti [35,49,79].

Sebbene i dati sull'effetto dell'attività fisica sui parametri strutturali del cervello siano scarsi, alcune evidenze indicano che la fisioterapia e il regolare allenamento fitness contrastano la degenerazione strutturale del tessuto cerebrale in pazienti con SM recidivante-remittente e possibilmente hanno un impatto neuroprotettivo. L'atrofia della materia grigia e bianca si verifica già nelle prime fasi della SM recidivante-remittente [80]. Tuttavia, i pazienti con un livello più alto di fitness aerobico hanno mostrato un volume locale relativamente più elevato di materia grigia nel giro post-centrale e nelle strutture corticali mediane compreso il giro anteriore del cingolo mediale e anteriore e la corteccia somatosensoriale del precuno di pazienti non idonei . Inoltre livelli di fitness più elevati erano associati a un maggiore reclutamento di regioni corticali mentre livelli di fitness inferiori erano associati ad attività della corteccia cingolata anteriore potenziata [81]. Questi dati devono tuttavia essere trattati con cautela poiché si basano su un piccolo campione di pazienti con SM femmina 24 con una vasta gamma di disabilità (EDSS 0-6) e durata della malattia (1-18 anni).

È stato dimostrato che i pazienti con SM hanno più aree cerebrali, spesso bilateralmente, attivate durante l'esecuzione di compiti motori e cognitivi rispetto ai controlli sani, possibilmente come espressione di neuroplasticità [82-92]. Il grado di attivazione ipsilaterale sembra correlare con il decorso e la gravità della malattia [85,88,93] ed è considerato in grado di riflettere i processi di riorganizzazione adattativa corticale [82,85,86]. Ad esempio, nei pazienti con sclerosi multipla in corso di malattia progressiva primaria l'attivazione corticale associata al movimento ha coinvolto aree "non motorie" come l'insula e diverse regioni corticali multimodali nei lobi temporali, parietali e occipitali oltre alle aree "classiche" di pianificazione motorio e regioni di esecuzione (compresa l'area del motore supplementare e l'area del motore cingolato) [93]. Morgen et al. hanno riferito che movimenti del pollice di pazienti MS non allenati hanno provocato un'attivazione più prominente della corteccia premotoria dorsale controlaterale nella fMRI rispetto ai controlli sani [85] che, a differenza dei controlli sani, non si attenuava sui movimenti ripetitivi del pollice.

Nei pazienti con SM il corpo calloso è tipicamente affetto. Oltre alle lesioni callosali rilevate mediante sequenze MRI standard, le sequenze di imaging del tensore di diffusione mostrano danni ultrastrutturali, riflessi da una ridotta anisotropia frazionaria e una maggiore diffusività media [79,94-98]. È interessante notare che in un piccolo studio comprendente pazienti con 11 MS e controlli sani, Ibrahim et al. ha descritto un aumento significativo dell'anisotropia frazionale e della diffusività media nel corpo calloso dopo un programma di fisioterapia di due mesi di 2 h alla settimana, suggerendo che la fisioterapia può influenzare la microstruttura cerebrale nella SM [79]. In sintesi, alcuni dati suggeriscono che gli effetti dell'attività fisica nei pazienti con SM possono essere riflessi da cambiamenti morfologici nel SNC che possono essere rilevati da tecniche di imaging avanzate. Tuttavia, i dati esistenti non sono ancora sufficienti a provare inequivocabilmente l'impatto dell'esercizio sulla struttura cerebrale nella SM.

Esercizio personalizzato nei pazienti con SM: raccomandazioni generali e specifiche

All'inizio di 1990, la raccomandazione generale del Sistema federale di monitoraggio federale tedesco di eseguire uno specifico programma di formazione sulla salute almeno tre volte alla settimana è stata sostituita da una prospettiva più globale, vale a dire l'integrazione delle attività fisiche quotidiane. Nella situazione dei pazienti con sclerosi multipla con un'attività quotidiana spesso ridotta, l'esercizio fisico regolare è particolarmente importante. Oltre a migliorare la forza muscolare, l'esercizio mira a migliorare la resistenza, il tono muscolare e la stabilità della postura, il grado di flessibilità e la resistenza dovrebbero coinvolgere sia gli agonisti che gli antagonisti [15,35]. Un programma di allenamento fisico deve essere adattato alle esigenze individuali e ai sintomi di un paziente. I fattori da considerare comprendono il decorso e lo stadio della malattia, il grado di disabilità, l'età, le malattie concomitanti e le sequele. È importante assicurarsi che il paziente non sia eccessivamente allenato [14-16].

Rispetto alle persone sane, i pazienti affetti da sclerosi multipla hanno una ridotta capacità aerobica [14,26,38], diminuzione della forza muscolare, velocità ritardata dello sviluppo della tensione muscolare, riduzione della resistenza muscolare e compromissione dell'equilibrio [14,15,36,99-101]. Una relazione tra la velocità dell'andatura e i parametri di forza è stata postulata [102]. Petajan e White hanno illustrato il livello di fitness muscolare e l'attività fisica dei pazienti con SM in due "piramidi": il range di movimento passivo (ROM) costituisce la base della piramide del fitness muscolare e può ridurre al minimo il rischio di contratture quando praticato regolarmente [16]. Il prossimo passo nella piramide comprende flessibilità attiva e esercizio di resistenza contro o senza gravità per mantenere l'integrità muscolare, ad esempio per consentire al paziente di svolgere le funzioni quotidiane essenziali. Un programma completo di esercizi di potenziamento muscolare rappresenta la parte superiore della piramide della forma fisica muscolare [16]. Le ADL costituiscono la base della piramide dell'attività fisica, seguita da inefficienze incorporate, ricreazione attiva e programmi strutturati di allenamento aerobico. Ancora una volta, il design, la frequenza e l'intensità dei programmi di allenamento devono essere adattati al singolo paziente. Esercizi basati sul peso come l'ergometria e l'esercizio in acqua sono particolarmente raccomandati per i pazienti con deficit motorio o disturbi dell'equilibrio [16].

Non esistono raccomandazioni specifiche per il trattamento di esercizio universalmente valide. Tuttavia, possono essere definite raccomandazioni terapeutiche generali. Poiché i programmi di allenamento non sono stati sufficientemente studiati in pazienti con disabilità più gravi, queste raccomandazioni sono limitate ai pazienti con SM con un punteggio EDSS massimo di 7 [14,15,34,38]. Qualsiasi nuovo programma di allenamento dovrebbe essere inizializzato da un fisioterapista o fisiologo esperto della malattia [14]. Una breve storia comprendente le menomazioni in particolare nelle attività quotidiane dovrebbe essere suscitata [16]. Indipendentemente dal tipo di esercizio, i programmi di allenamento dovrebbero essere semplici e comprensibili per i pazienti. Se necessario, potrebbe essere consigliabile spiegare i programmi di allenamento in forma scritta o illustrata [15]. I pazienti devono essere sorvegliati fino a quando possono eseguire il programma in modo adeguato e indipendente [14-16,26]. I programmi di allenamento dovrebbero mirare in modo specifico ai muscoli più deboli e dovrebbero preferibilmente comprendere movimenti complessi multisegmentali [15,35]. L'intensità dovrebbe essere aumentata solo lentamente, e non fino al punto di dolore [15]. Prestare particolare attenzione ai nervi periferici; in particolare dovrebbe essere evitato il sovradimensionamento [15]. Si consiglia di iniziare le sessioni di allenamento a un livello basso, includere un leggero riscaldamento, progredire in base allo stato clinico dei pazienti e a problemi specifici e infine raggiungere un'intensità da leggera a moderata [14-16,26]. 10-15 min di stretching giornaliero per mantenere e migliorare la flessibilità di muscoli e tendini [15] e tempi di recupero tra le sessioni di allenamento di 24-48 h sono raccomandati [15]. I pazienti immobilizzati o quelli con sintomi clinici severi devono essere assistiti individualmente. Alcuni autori suggeriscono che la funzione cardiopolmonare e VO2-max devono essere valutati prima dell'inizio del trattamento poiché i pazienti con sclerosi multipla possono avere una risposta cardiaca ridotta nei test di esercizi graduati, possibilmente come espressione di disautonomia cardiovascolare [15,16], anche se probabilmente non può essere implementata in la routine quotidiana. Per quanto riguarda l'allenamento di resistenza e secondo l'American College of Sports Medicine, White e Dressendorfer consigliano di utilizzare la risposta effettiva della frequenza cardiaca a test di esercizi graduati per trovare l'intervallo cardiaco obiettivo ideale per l'allenamento [15]. Nessun sintomo dovrebbe apparire e "intensità moderata" dovrebbe essere perseguita, per esempio mediante la scala dei Borg dello sforzo percepito, che va da 6 a 20 (6 significa "niente sforzo", 20 significa "sforzo massimo"). Per intensità moderate vanno da 11 a 14 [15,103]. A seconda dei sintomi e del programma di allenamento, gli esercizi devono essere eseguiti a casa, individualmente, con un compagno di allenamento o con un gruppo di allenamento e possono includere attrezzature di allenamento come elastici, pesi aggiuntivi e sistemi di pulegge. Grazie al suo supporto sociale, un gruppo di formazione sembra essere favorevole in termini di conformità e motivazione [16,28]. Per ottenere effetti simili nei programmi di formazione domiciliare, i pazienti devono essere strettamente sorvegliati, ad esempio mediante visite o telefonate [16,28]. Soprattutto, le sessioni di allenamento devono essere eseguite regolarmente [14-16,26].

Sono state pubblicate alcune raccomandazioni speciali sull'allenamento per i pazienti con SM. Tuttavia, è necessario sottolineare che queste raccomandazioni rappresentano per lo più esperienze personali fatte dagli autori e non sono sempre supportate da studi clinici di alto livello. Dalgas et al., Ad esempio, hanno raccomandato un allenamento di resistenza di circa 10-40 durata min, con un'intensità di allenamento iniziale di 50-70% di VO2-max corrispondente a 60-80% della frequenza cardiaca massima [14]. Secondo Dalgas et al., Si raccomanda l'allenamento di resistenza per comprendere inizialmente le ripetizioni 8-15 che possono poi essere aumentate per diversi mesi. L'allenamento dovrebbe iniziare con i set 1-3, successivamente i set 3-4 con una pausa minima 2-4 tra i set e dovrebbero essere eseguiti due o tre volte alla settimana. Per i pazienti sensibili al calore e coloro che sviluppano regolarmente il fenomeno dell'allenamento di Uhthoff al mattino o in acqua a temperature di 27-28 ° C potrebbe essere preferibile poiché la temperatura corporea è fisiologicamente più bassa all'inizio della giornata e il calore generato dall'attività fisica viene rapidamente dissipato in acqua [15,16]. In alternativa, il raffreddamento prima dell'esercizio e / o durante l'attività fisica, ad esempio mediante impacchi freddi, può aiutare a prevenire il fenomeno di Uhthoff [15,16,55]. Inoltre, la resistenza anziché l'allenamento di resistenza potrebbe essere preferibile per i pazienti sensibili al calore [14].

Dr Jimenez White Coat
La sclerosi multipla, o SM, è una malattia cronica, generalmente progressiva, causata quando il sistema immunitario danneggia le guaine delle cellule nervose nel cervello e nel midollo spinale. Per molti anni, i medici hanno raccomandato ai pazienti con SM di evitare qualsiasi tipo di attività fisica o esercizio fisico, tuttavia, recenti studi di ricerca hanno scoperto che restare attivi può essere utile per i sintomi della SM. I sintomi comuni associati alla sclerosi multipla comprendono intorpidimento, menomazione della parola e della coordinazione muscolare, visione offuscata e grave affaticamento. Dr. Alex Jimenez DC, CCST Insight

Approcci di terapia fisica per prevenire o attenuare i singoli sintomi target e i segni nella SM

stanchezza

L'affaticamento, definito come un'estrema stanchezza fisica e mentale inadeguata alla domanda precedente, è un sintomo frequente, spesso molto debilitante nella SM, che è generalmente difficile da trattare [8-10,15,35,104-106]. Approssimativamente il 75-90% di tutti i pazienti affetti da SM manifesta affaticamento durante la progressione della malattia [8,10,16] e alcuni pazienti SM finiscono in un circolo vizioso: per ridurre l'affaticamento diminuiscono l'attività fisica che nel tempo riduce la resistenza, la forza muscolare e la qualità della vita e può aumentare la fatica, che quindi a sua volta limita ulteriormente l'attività fisica e la vita sociale [9,42,49]. Oltre al raffreddamento, l'esercizio moderato, in particolare l'allenamento aerobico, sembra avere un effetto positivo sulla fatica [30,35,45]. Poiché la fatica aumenta spesso nel corso della giornata, le sessioni di allenamento dovrebbero essere svolte al mattino e non devono sovraesperare il paziente [104]. Sostegno speciale come la partecipazione a un gruppo di formazione o la partecipazione a sostegno psicologico per aumentare la motivazione per il proseguimento della formazione nel tempo potrebbe essere vantaggioso in pazienti affetti da affaticamento [16]. Vengono inoltre applicate strategie di risparmio energetico, in cui il paziente impara a stabilire le priorità e ad eseguire le attività quotidiane con un minimo sforzo [4,16,27]. Sebbene alcuni autori [14,28,35,41] abbiano descritto un effetto benefico di moderato esercizio sulla fatica, gli effetti sono generalmente insufficienti per ottenere miglioramenti significativi nelle attuali scale di fatica [17,35,45,47,50]. Altri studi non sono riusciti a rilevare alcun miglioramento [33]. Una spiegazione per i risultati contraddittori può essere trovata nell'uso di diverse scale di fatica, che si concentrano sui sintomi fisici, o in presenza di disturbi del sonno come insonnia, disturbi respiratori correlati al sonno, sindrome delle gambe senza riposo, disturbi del movimento degli arti periodici [104-106] . In conclusione, ci sono alcune prove, tuttavia non inequivocabili, per gli effetti benefici da bassi a moderati di un moderato esercizio sulla fatica.

La spasticità

Con una prevalenza per tutta la vita di circa 90% di spasticità è frequente nella SM e ha un potenziale per ridurre significativamente la qualità della vita [104]. Porta a limiti nella gamma e alla normale ricerca dei movimenti, provoca il mal posizionamento delle articolazioni ed è spesso accompagnato da dolore [24]. Gli studi controllati sull'esercizio fisico e sulla fisioterapia per la spasticità correlata alla SM sono rari; tuttavia sono state riportate alcune prove di miglioramento [104].

Le misure di fisioterapia includono l'esercizio attivo e passivo (es. Posizionamento mirato del paziente, esercizio passivo con cicli motorizzati, esercizio di tapis roulant attivo) che può essere assistito da un compagno di allenamento o da attrezzature di allenamento come le fasce elastiche. Tra le terapie applicate figurano le tecniche fisioterapeutiche secondo Bobath o Vojta e la facilitazione neuromuscolare propriocettiva (PNF). Nessuna di queste misure è stata dimostrata superiore [104,107]. È molto importante eseguirli regolarmente e con una sufficiente intensità [4,104]. Lo stretching leggero dei gruppi muscolari interessati con una durata di circa 20-60 deve essere eseguito prima e dopo l'esercizio [15].

paresi

Le paresi portano a varie disabilità fisiche, come la difficoltà a camminare e la disfunzione motoria. È stata dimostrata una relazione tra velocità dell'andatura e forza muscolare nei pazienti con SM [14]. Poiché non esiste alcun trattamento farmacologico per parenti e farmaci antispastici come il baclofen possono anche portare ad un peggioramento delle parenti esistenti, le sole tecniche di terapia fisica e occupazionale sono l'unica opzione di trattamento. A causa del ridotto impatto della gravità, l'allenamento acquatico consente ai pazienti con paresi anche gravi degli arti inferiori di eseguire esercizi in piedi e in movimento [15,16]. Un sostegno permanente può aiutare i pazienti che non sono in grado di stare in piedi, allenare muscoli del tronco, degli arti e della respirazione e proteggere contro la disregolazione cardiovascolare. Per i pazienti immobilizzati, si raccomanda un range passivo di esercizi di movimento prossimale alla regione paralizzata [15,16]. Vari studi hanno mostrato un significativo miglioramento della forza muscolare a causa dell'esercizio [33,35,40,101]. Inoltre, alcuni autori hanno riportato effetti benefici nella velocità di camminata, nella resistenza allo stepping, nel salire le scale e nel salire e scadere il test [35,40,49]. In sintesi, le prove suggeriscono che l'esercizio è benefico nel trattamento delle paresi correlate alla SM, tuttavia, di nuovo, sono disponibili solo pochi dati parzialmente incoerenti. Inoltre, gli effetti dell'esercizio fisico sono stati studiati quasi esclusivamente in pazienti affetti da SM con compromissione lieve o moderata.

Coordinamento e disfunzione dell'equilibrio

Le anormalità nel controllo dell'equilibrio sono sintomi frequenti nei pazienti con sclerosi multipla, che limitano i pazienti nelle loro attività di vita quotidiana e aumentano il rischio di cadute [5]. Bilanciare le abilità come stare in piedi e camminare, così come la percezione del proprio equilibrio da parte dei pazienti, è importante per valutare [5]. La posizione seduta dell'addestramento ciclistico è vantaggiosa per i pazienti instabili [15,16]. Solo pochi studi hanno studiato l'influenza dei programmi di allenamento sull'equilibrio e il coordinamento nella SM e pochissimi hanno scelto queste variabili come parametro di esito primario. Catteneo et al., Ad esempio, hanno studiato l'effetto dell'allenamento dell'equilibrio nei pazienti con 44 MS in uno studio controllato randomizzato [5]. Due gruppi di trattamento hanno ricevuto una particolare riabilitazione dell'equilibrio per tre settimane, un terzo gruppo (di controllo) ha partecipato a un programma di allenamento non specifico. In entrambi i gruppi di trattamento, è stato possibile rilevare una riduzione del numero di cadute e un miglioramento nei test clinici di equilibrio statico (scala dell'equilibrio di Berg) e del bilancio dinamico (Dynamic Gait Index). Tuttavia, nelle scale di autovalutazione i pazienti non hanno riportato miglioramenti significativi [5]. Un altro studio controllato non ha supportato un effetto benefico dell'allenamento sull'equilibrio statico [34].

Disturbi cognitivi e dell'umore

A seconda del decorso della malattia e dello stadio 45-70% dei pazienti con SM sono affetti da disturbi cognitivi quali ridotta velocità di elaborazione delle informazioni, deficit attenzionali e deficit di memoria episodica [12,13,24,104,108] e 60-70% di disturbi dell'umore [13,109,110]. Sono state descritte alcune prove di una correlazione positiva tra esercizio aerobico e cognizione e funzione cerebrale in persone sane [81]. Nei pazienti con SM, sono stati segnalati ripetutamente effetti benefici dell'attività fisica regolare e dell'esercizio dell'umore [18,32,35,48] e della qualità della vita [14,15,28,34]. Dati validi sull'effetto sulla funzione cognitiva sono difficilmente disponibili.

Conclusione e Outlook

Diverse linee di evidenza suggeriscono che i pazienti affetti da sclerosi multipla traggono vantaggio dall'attività fisica regolare e dall'esercizio di parametri clinici, di imaging e fisiologici di alta qualità. Tuttavia, la qualità delle sperimentazioni cliniche finora realizzate sull'esercizio fisico negli Stati membri non sempre soddisfa i requisiti di uno studio di alto livello. Inoltre, a causa dei diversi paradigmi e endpoint di trattamento, i dati sono spesso difficilmente comparabili. Pertanto, molte domande rimangono ancora senza risposta. Di conseguenza, vi è un grande bisogno di studi standardizzati di alta qualità e ben descritti che affrontino sia gli effetti a breve che a lungo termine dell'esercizio sui parametri clinici e paraclinici nei pazienti affetti da SM con diversi corsi di malattia e diversi gradi di disabilità.

Conflitti di interessi

Gli autori dichiarano di non avere interessi in gioco.

Ringraziamenti

Questo lavoro è stato supportato dal DFG (Exc 257).

Per le persone 400,000 stimate negli Stati Uniti che vivono con la sclerosi multipla, la partecipazione ad attività fisiche ed esercizi può avere enormi benefici per la salute. Sebbene gli operatori sanitari sostengano la limitazione dell'esercizio per i pazienti con SM, molti studi di ricerca come quello sopra hanno dimostrato che l'esercizio fisico può aiutare a migliorare i sintomi della sclerosi multipla, migliorando la qualità della vita di un paziente. Per le persone con SM, la loro vita non deve fermarsi. Lo scopo delle nostre informazioni è limitato ai problemi di salute chiropratica e spinale. Per discutere l'argomento, non esitate a chiedere al Dr. Jimenez o contattaci a 915-850-0900 .

A cura di Dr. Alex Jimenez

Riferito da: Ncbi.nlm.nih.gov/pmc/articles/PMC3375103/

Pulsante Green Call Now H .png

Discussione aggiuntiva sull'argomento: mal di schiena acuto

Mal di schiena è una delle più diffuse cause di disabilità e giorni persi al lavoro in tutto il mondo. Il dolore alla schiena è il secondo motivo più comune per le visite di un medico, superate solo dalle infezioni delle alte vie respiratorie. Circa il 80 percento della popolazione subirà un dolore alla schiena almeno una volta nella vita. La colonna vertebrale è una struttura complessa composta da ossa, articolazioni, legamenti e muscoli, tra gli altri tessuti molli. Lesioni e / o condizioni aggravate, come dischi erniciati, può eventualmente portare a sintomi di mal di schiena. Le lesioni sportive o gli incidenti automobilistici sono spesso la causa più frequente di mal di schiena, tuttavia a volte il più semplice dei movimenti può avere risultati dolorosi. Fortunatamente, le opzioni di trattamento alternative, come la cura chiropratica, possono aiutare ad alleviare il mal di schiena attraverso l'uso di aggiustamenti spinali e manipolazioni manuali, in definitiva migliorando il sollievo dal dolore.

foto di blog del fumetto carta ragazzo

EXTRA EXTRA | ARGOMENTO IMPORTANTE: consigliato El Paso, TX Chiropractor

***

Quali sono i vantaggi di Nrf2?

Quali sono i vantaggi di Nrf2?

Lo stress ossidativo è un importante contributo allo sviluppo di una varietà di problemi di salute, tra cui il cancro, le malattie cardiache, il diabete, l'invecchiamento accelerato e la neurodegenerazione. Alimenti ricchi di antiossidanti, erbe e integratori possono essere utilizzati per proteggere il corpo umano da elevati livelli di stress ossidativo. Recenti studi di ricerca hanno dimostrato che il Via del gene Nrf2 può aiutare ad amplificare gli effetti degli antiossidanti. Il Benefici di Nrf2 sono descritti di seguito.

Protegge il corpo contro le tossine

NRF2 è una sostanza intrinseca in grado di proteggere le cellule da composti dannosi, interni ed esterni. NRF2 può aiutare ad arricchire la reazione del corpo umano a farmaci / farmaci e tossine, migliorando la produzione di proteine ​​che aiutano a eliminare i composti dalla cellula, noti come proteine ​​associate alla resistenza dei farmaci o MRP. A titolo di esempio, NRF2 viene attivato dall'inalazione del fumo di sigaretta per consentire ai polmoni di disintossicarsi.

Inoltre, è essenziale che i polmoni proteggano gli allergeni, le malattie virali, le endotossine batteriche, l'iperossia e vari inquinanti ambientali. L'innesco costante di Nrf2 tuttavia, può diminuire i livelli di una sostanza conosciuta come glutatione in tutto il corpo umano. NRF2 può anche proteggere il fegato dalla tossicità e può proteggere il fegato dall'epatotossicità da arsenico. Inoltre, NRF2 protegge il fegato e il cervello dal consumo di alcol. A titolo di esempio, Nrf2 può proteggere dalla tossicità del paracetamolo.

Combatte l'infiammazione e lo stress ossidativo

L'attivazione di NRF2 può aiutare a combattere l'infiammazione diminuendo le citochine infiammatorie, come quelle presenti nella psoriasi. NRF2 può anche ridurre l'infiammazione associata a una varietà di problemi di salute come l'artrite e la fibrosi del fegato, dei reni e dei polmoni. NRF2 può anche aiutare a controllare le allergie abbassando le citochine Th1 / Th17 e aumentando le citochine TH2. Questo può essere utile per disturbi come l'asma.

NRF2 protegge inoltre dai danni cellulari dalla luce blu e dai raggi UVA / UVB presenti alla luce solare. Le carenze di Nrf2 possono rendere molto più facile scottarsi. Un motivo dietro questo è perché NRF2 è in grado di regolare il collagene in risposta alle radiazioni UV. I prodotti finali Glycation avanzati, o AGE, contribuiscono allo sviluppo di molti problemi di salute, tra cui il diabete e le malattie neurodegenerative. NRF2 può ridurre lo stress ossidativo degli AGE all'interno del corpo. NRF2 può anche proteggere il corpo umano da livelli più elevati di stress basato sul calore.

Migliora i mitocondri e le prestazioni degli esercizi

NRF2 è un ripetitore mitocondriale. L'attivazione di NRF2 contribuisce a un aumento dell'energia ATP per i mitocondri, oltre a un maggiore uso di ossigeno, citrato e grassi. Senza NRF2, i mitocondri avrebbero solo la capacità di funzionare con zucchero, o glucosio, piuttosto che con il grasso. NRF2 è anche essenziale per sviluppare i mitocondri attraverso un processo noto come biogenesi. L'attivazione di NRF2 è vitale per trarre vantaggio dai benefici dell'esercizio.

A causa dell'attività di Nrf2, l'esercizio solleva la funzione mitocondriale, dove questo risultato può essere amplificato con CoQ10, Cordyceps e Caloric Restriction. Esercizio fisico moderato o esercizio acuto induce biogenesi mitocondriale e una sintesi elevata di superossido dismutasi, o SOD e eme-ossigenasi-1, o HO-1, attraverso l'attivazione di NRF2. L'acido alfa-lipoico, o ALA e Dan Shen possono potenziare la biogenesi mitocondriale mediata da NRF2. Inoltre, NRF2 può anche migliorare la tolleranza all'esercizio in cui la soppressione di NRF2 rende l'esercizio dannoso.

Protegge dall'ipossia

NRF2 aiuta anche a proteggere il corpo umano dalla perdita / esaurimento di ossigeno cellulare, un problema di salute chiamato ipossia. Gli individui con CIRS hanno livelli ridotti di ossigeno poiché il loro NRF2 è ostruito, con conseguente riduzione dei livelli di VEGF, HIF1 e HO-1. Ordinariamente, in individui sani con ipossia, miR-101, che è richiesto per la creazione di cellule staminali, sono sovraespressi e aumentano le quantità di NRF2 / HO-1 e VEGF / eNOS, quindi prevengono danni cerebrali, ma ciò non sembra verificarsi in CIRS.

L'ipossia, caratterizzata da un basso HIF1, nel CIRS può anche causare una perdita di sangue nella barriera emato-encefalica a causa di uno squilibrio NRF2. Il salidroside, situato nella Rhodiola, funziona sull'attivazione di NRF2 e aiuta l'ipossia aumentando i livelli di VEGF e HIF1 all'interno del corpo umano. NRF2 può anche proteggere l'accumulo di lattato nel cuore. L'attivazione di NRF2 può anche interrompere la malattia del movimento di altitudine indotta dall'ipossia, o AMS.

Rallenta l'invecchiamento

Diversi composti che possono essere fatali in quantità massicce possono aumentare la longevità in quantità piuttosto piccole a causa della xenoormesi attraverso NRF2, PPAR-gamma e FOXO. Una quantità molto piccola di tossine aumenta la capacità della cellula di diventare meglio equipaggiata per la prossima volta che viene sfidata con una tossina, tuttavia, questo non è un'approvazione per consumare sostanze chimiche velenose.

Una buona illustrazione di questo processo è con la restrizione calorica. NRF2 può migliorare la durata delle cellule aumentando i loro livelli di mitocondri e antiossidanti e diminuendo la capacità delle cellule di morire. NRF2 diminuisce con l'invecchiamento perché NRF2 impedisce alle cellule staminali di morire e li aiuta a rigenerarsi. NRF2 svolge un ruolo nel migliorare la guarigione delle ferite.

Aumenta il sistema vascolare

Effettuato correttamente con la produzione di sulforafano, l'attivazione di NRF2 può proteggere da malattie cardiache quali ipertensione, ipertensione e indurimento delle arterie o aterosclerosi. NRF2 può migliorare l'attività dell'acetilcolina, o ACh, rilassante sul sistema vascolare riducendo lo stress indotto dal colesterolo. L'attivazione di Nrf2 può rafforzare il cuore, tuttavia, Nrf2 sovraattivato può aumentare la probabilità di malattie cardiovascolari.

Le statine possono prevenire o portare a malattie cardiovascolari. NRF2 svolge anche un ruolo importante nel bilanciare ferro e calcio che possono proteggere il corpo umano da livelli elevati di ferro. Ad esempio, Sirtuin 2, o SIRT2, è in grado di regolare l'omeostasi del ferro nelle cellule mediante l'attivazione di NRF2 che si ritiene sia necessaria per livelli sani di ferro. NRF2 può anche aiutare con Sickle Cell Disease, o SCD. La disfunzione di NRF2 potrebbe essere un motivo alla base dell'endotossemia come la disbiosi o l'ipertensione indotta da lectine. Nrf2 può anche proteggere il corpo umano dai danni indotti dall'anfetamina al sistema vascolare.

Combatte la neuroinfiammazione

NRF2 può schermare e aiutare con l'infiammazione del cervello, comunemente indicata come neuroinfiammazione. Inoltre, NRF2 può aiutare con un Assortimento di Sistema Nervoso Centrale, o CNS, disturbi, tra cui:

  • La malattia di Alzheimer (AD) - riduce lo stress beta-amiloide sui mitocondri
  • Sclerosi Laterale Amiotrofica (SLA)
  • La malattia di Huntington (HD)
  • La sclerosi multipla (SM)
  • Nerve Regeneration
  • Morbo di Parkinson (PD) - protegge la dopamina
  • Infortunio al midollo spinale (SCI)
  • Ictus (ischemico ed emorragico) - aiuta l'ipossia
  • Brain Injury traumatica

NRF2 ha rivelato una diminuzione della neuroinfiammazione negli adolescenti con disturbi dello spettro autistico o ASD. Idebenone si accoppia correttamente con attivatori NRF2 contrari alla neuroinfiammazione. NRF2 può anche migliorare la barriera emato-encefalica, o BBB. A titolo di esempio, l'attivazione di NRF2 con acido carnosico ottenuto da rosmarino e salvia può attraversare il BBB e causare la neurogenesi. NRF2 ha anche dimostrato di aumentare il fattore neurotrofico derivato dal cervello, o BDNF.

NRF2 modula anche alcuni supplementi nutrizionali in grado di causare il fattore di crescita dei nervi, o NGF in quanto può anche aiutare con problemi di nebbia cerebrale e induzione del glutammato modulando i recettori N-Metil-D-Aspartato o NMDA. Può anche ridurre lo stress ossidativo da acido chinolinico, denominato QUIN. L'attivazione di NRF2 può proteggere dalle convulsioni e grandi dosi possono ridurre l'orlo di un attacco. A dosi regolari di stimolazione, NRF2 può potenziare le capacità cognitive a seguito di un attacco epilettico abbassando il glutammato extracellulare nel cervello e grazie alla sua capacità di estrarre la cisteina dal glutammato e dal glutatione.

Allevia la depressione

Nella depressione, è normale notare un'infiammazione nel cervello, specialmente dalla corteccia prefrontale e dall'ippocampo, così come una riduzione del BDNF. In alcune versioni della depressione, NRF2 può migliorare i sintomi depressivi abbassando l'infiammazione all'interno del cervello e aumentando i livelli di BDNF. La capacità di agmatina di ridurre la depressione aumentando la noradrenalina, la dopamina, la serotonina e il BDNF nell'ippocampo dipende dall'attivazione di NRF2.

Contiene proprietà anti-cancro

NRF2 è ugualmente un soppressore del tumore in quanto è un promotore del tumore se non gestito di conseguenza. NRF2 può proteggere contro il cancro causato dai radicali liberi e dallo stress ossidativo, tuttavia, la sovraespressione di NRF2 può essere riscontrata anche nelle cellule tumorali. L'intensa attivazione di NRF2 può aiutare con una varietà di tumori. Ad esempio, il supplemento Protandim può ridurre il cancro della pelle mediante l'attivazione di NRF2.

Allevia il dolore

La malattia della guerra del Golfo, o GWI, una malattia notevole che colpisce i veterani della Guerra del Golfo, è una raccolta di sintomi cronici inspiegabili che possono includere stanchezza, mal di testa, dolori articolari, indigestione, insonnia, vertigini, disturbi respiratori e problemi di memoria. NRF2 può migliorare i sintomi del GWI diminuendo l'infiammazione ippocampale e generale, oltre a diminuire il dolore. NRF2 può inoltre aiutare con il dolore delle lesioni del nervo corporeo e migliorare i danni ai nervi della neuropatia diabetica.

Migliora il diabete

Livelli elevati di glucosio, meglio denominati iperglicemia, provocano danni ossidativi alle cellule a causa dell'interruzione della funzione mitocondriale. L'attivazione di NRF2 può proteggere il corpo umano dai danni dell'iperglicemia alla cellula, prevenendo così la morte cellulare. L'attivazione di NRF2 può inoltre proteggere, ripristinare e migliorare la funzionalità delle cellule beta del pancreas, riducendo al contempo la resistenza all'insulina.

Protegge la vista e l'udito

NRF2 può proteggere dai danni agli occhi causati dalla retinopatia diabetica. Potrebbe anche evitare la formazione di cataratta e proteggere i fotorecettori contrariamente alla morte indotta dalla luce. NRF2 protegge inoltre l'orecchio o la coclea dallo stress e dalla perdita dell'udito.

Potrebbe aiutare l'obesità

NRF2 può aiutare con l'obesità principalmente a causa della sua capacità di regolare le variabili che operano sull'accumulo di grasso nel corpo umano. L'attivazione di NRF2 con sulforafano può aumentare l'inibizione della sintesi degli acidi grassi, o FAS, e le proteine ​​di disaccoppiamento, o UCP, con conseguente minore accumulo di grasso e più grasso bruno, caratterizzato da grasso che include più mitocondri.

Protegge l'intestino

NRF2 aiuta a proteggere l'intestino salvaguardando l'omeostasi del microbioma intestinale. A titolo di esempio, i probiotici lactobacillus attiveranno NRF2 per proteggere l'intestino dallo stress ossidativo. NRF2 può anche aiutare a prevenire la colite ulcerosa o UC.

Protegge gli organi sessuali

NRF2 può proteggere i testicoli e mantenere il conteggio degli spermatozoi dalle persone colpite da diabete. Può anche aiutare con la disfunzione erettile, o ED. Alcuni supplementi di aumento della libido come Mucuna, Tribulus e Ashwaganda possono migliorare la funzione sessuale tramite l'attivazione di NRF2. Altri fattori che potenziano NRF2, come la luce solare oi germogli di broccoli, possono anche aiutare a migliorare la libido.

Regola le ossa e i muscoli

Lo stress ossidativo può determinare la densità ossea e la riduzione della forza, che è normale nell'osteoporosi. L'attivazione di NRF2 potrebbe avere la capacità di migliorare gli antiossidanti nelle ossa e proteggere dall'invecchiamento osseo. NRF2 può anche prevenire la perdita muscolare e migliorare la distrofia muscolare di Duchenne, o DMD.

Contiene proprietà anti-virali

Ultimo ma non meno importante, l'attivazione di NRF2 può infine aiutare a difendere il corpo umano da diversi virus. Nei pazienti con il virus della dengue, i sintomi non erano così intensi negli individui che avevano livelli più elevati di NRF2 rispetto ai soggetti che avevano meno gradi di NRF2. NRF2 può anche aiutare le persone che hanno l'Immunodeficienza Umana-1 Virus o l'HIV. NRF2 può proteggere dallo stress ossidativo del virus Adeno-Associated, o AAV e H. Pylori. Infine, Lindera Root può sopprimere il virus dell'epatite C con l'attivazione di NRF2.

Dr Jimenez White Coat
Nrf2, o fattore 2 correlato a NF-E2, è un fattore di trascrizione trovato nell'uomo che regola l'espressione di un insieme specifico di geni antiossidanti e disintossicanti. Questa via di segnalazione è attivata a causa dello stress ossidativo poiché potenzia numerosi enzimi antiossidanti e di disintossicazione epatica di fase II per ripristinare l'omeostasi nel corpo umano. Gli esseri umani sono adattati per funzionare in uno stato di omeostasi o equilibrio. Quando il corpo si confronta con lo stress ossidativo, Nrf2 si attiva per regolare l'ossidazione e controllare lo stress che provoca. Nrf2 è essenziale per prevenire problemi di salute associati allo stress ossidativo. Dr. Alex Jimenez DC, CCST Insight

Sulforaphane e suoi effetti su cancro, mortalità, invecchiamento, cervello e comportamento, malattie cardiache e altro ancora

Gli isotiocianati sono alcuni dei composti vegetali più importanti che si possono ottenere nella dieta. In questo video faccio il caso più completo per loro che sia mai stato fatto. Soglia di attenzione breve? Passa al tuo argomento preferito facendo clic su uno dei seguenti punti temporali. Timeline completa di seguito.

Sezioni chiave:

  • 00: 01: 14 - Cancro e mortalità
  • 00: 19: 04 - Invecchiamento
  • 00: 26: 30 - Cervello e comportamento
  • 00: 38: 06 - Riassunto finale
  • 00: 40: 27 - Dose

Timeline completa:

  • 00: 00: 34 - Introduzione di sulforaphane, uno degli obiettivi principali del video.
  • 00: 01: 14 - Consumo di verdure crocifere e riduzione della mortalità per tutte le cause.
  • 00: 02: 12 - Rischio di cancro alla prostata.
  • 00: 02: 23 - Rischio di cancro alla vescica.
  • 00: 02: 34 - Carcinoma polmonare nei fumatori.
  • 00: 02: 48 - Rischio di cancro al seno.
  • 00: 03: 13 - Ipotetico: cosa succede se hai già un cancro? (Interventistica)
  • 00: 03: 35 - Meccanismo plausibile che guida i dati associativi sul cancro e sulla mortalità.
  • 00: 04: 38 - Sulforaphane e cancro.
  • 00: 05: 32 - Prova animale che mostra un forte effetto dell'estratto di germogli di broccolo sullo sviluppo del tumore della vescica nei ratti.
  • 00: 06: 06 - Effetto dell'integrazione diretta di sulforafano nei pazienti affetti da cancro alla prostata.
  • 00: 07: 09 - Bioaccumulo di metaboliti di isotiocianato nel tessuto mammario effettivo.
  • 00: 08: 32 - Inibizione delle cellule staminali del carcinoma mammario.
  • 00: 08: 53 - Lezione di storia: le brassiche sono state istituite come aventi proprietà sanitarie anche nell'antica Roma.
  • 00: 09: 16 - La capacità del Sulforaphane di potenziare l'escrezione di cancerogeno (benzene, acroleina).
  • 00: 09: 51 - NRF2 come interruttore genetico tramite elementi di risposta antiossidante.
  • 00: 10: 10 - Come l'attivazione di NRF2 migliora l'escrezione di cancerogeno tramite glutatione-S-coniugati.
  • 00: 10: 34 - I cavoletti di Bruxelles aumentano la glutatione-S-transferasi e riducono il danno al DNA.
  • 00: 11: 20 - La bevanda di germogli di broccoli aumenta l'escrezione di benzene di 61%.
  • 00: 13: 31 - L'omogenato di germogli di broccoli aumenta gli enzimi antiossidanti nelle vie aeree superiori.
  • 00: 15: 45 - Consumo di verdure crocifere e mortalità per malattie cardiache.
  • 00: 16: 55 - La polvere di germogli di broccoli migliora i lipidi nel sangue e il rischio complessivo di malattie cardiache nei diabetici di tipo 2.
  • 00: 19: 04 - Inizio della sezione di invecchiamento.
  • 00: 19: 21 - La dieta arricchita con sulforafano migliora la durata della vita dei coleotteri da 15 a 30% (in determinate condizioni).
  • 00: 20: 34 - L'importanza della bassa infiammazione per la longevità.
  • 00: 22: 05 - Le verdure crocifere e la polvere di germogli di broccoli sembrano ridurre un'ampia varietà di marcatori infiammatori negli esseri umani.
  • 00: 23: 40 - Ricapitolazione di metà video: cancro, sezioni di invecchiamento
  • 00: 24: 14 - Gli studi sui topi suggeriscono che il sulforafano potrebbe migliorare la funzione immunitaria adattativa in età avanzata.
  • 00: 25: 18 - Sulforaphane ha migliorato la crescita dei peli in un modello murino di calvizie. Immagine su 00: 26: 10.
  • 00: 26: 30 - Inizio della sezione cervello e comportamento.
  • 00: 27: 18 - Effetto dell'estratto di germogli di broccoli sull'autismo.
  • 00: 27: 48 - Effetto del glucorapanin sulla schizofrenia.
  • 00: 28: 17 - Inizio della discussione sulla depressione (meccanismo e studi plausibili).
  • 00: 31: 21 - Lo studio del mouse utilizzando 10 diversi modelli di depressione indotta da stress mostra sulforapano in modo simile efficace come fluoxetina (prozac).
  • 00: 32: 00 - Lo studio mostra che l'ingestione diretta di glucorafanina nei topi è altrettanto efficace nel prevenire la depressione dal modello di stress sociale di sconfitta.
  • 00: 33: 01 - Inizio della sezione di neurodegenerazione.
  • 00: 33: 30 - Sulforaphane e malattia di Alzheimer.
  • 00: 33: 44 - Sulforaphane e morbo di Parkinson.
  • 00: 33: 51 - Sulforaphane e la malattia di Hungtington.
  • 00: 34: 13 - Sulforaphane aumenta le proteine ​​da shock termico.
  • 00: 34: 43 - Inizio della sezione traumatica di lesioni cerebrali.
  • 00: 35: 01 - Sulforaphane iniettato immediatamente dopo TBI migliora la memoria (studio del mouse).
  • 00: 35: 55 - Sulforaphane e plasticità neuronale.
  • 00: 36: 32 - Sulforaphane migliora l'apprendimento nel modello di diabete di tipo II nei topi.
  • 00: 37: 19 - Distrofia muscolare sulforapano e duchenne.
  • 00: 37: 44 - Inibizione della miostatina nelle cellule muscolari satelliti (in vitro).
  • 00: 38: 06 - Ricapitolazione tardiva: mortalità e cancro, danno al DNA, stress ossidativo e infiammazione, escrezione di benzene, malattie cardiovascolari, diabete di tipo II, effetti sul cervello (depressione, autismo, schizofrenia, neurodegenerazione), via NRF2.
  • 00: 40: 27 - Pensieri sulla determinazione di una dose di germogli di broccoli o sulforafano.
  • 00: 41: 01 - Aneddoti su germinazione a casa.
  • 00: 43: 14 - Sulle temperature di cottura e sull'attività del sulforafano.
  • 00: 43: 45 - Conversione batterica intestinale del sulforafano da glucorafanina.
  • 00: 44: 24 - Gli integratori funzionano meglio se combinati con la mirosinasi attiva delle verdure.
  • 00: 44: 56 - Tecniche di cottura e verdure crucifere.
  • 00: 46: 06 - Isotiocianati come goitrogens.

Quando il corpo umano si confronta con fattori interni ed esterni dannosi come le tossine, le cellule devono attivare rapidamente le loro capacità antiossidanti per contrastare lo stress ossidativo. Poiché l'aumento dei livelli di stress ossidativo è stato determinato a causare una serie di problemi di salute, è importante utilizzare l'attivazione Nrf2 per sfruttare i suoi benefici. Lo scopo delle nostre informazioni è limitato ai problemi di salute chiropratica e spinale. Per discutere l'argomento, non esitate a chiedere al Dr. Jimenez o contattaci a 915-850-0900 .

A cura di Dr. Alex Jimenez

Pulsante Green Call Now H .png

Discussione aggiuntiva sull'argomento: mal di schiena acuto

Mal di schiena è una delle più diffuse cause di disabilità e giorni persi al lavoro in tutto il mondo. Il dolore alla schiena è il secondo motivo più comune per le visite di un medico, superate solo dalle infezioni delle alte vie respiratorie. Circa il 80 percento della popolazione subirà un dolore alla schiena almeno una volta nella vita. La colonna vertebrale è una struttura complessa composta da ossa, articolazioni, legamenti e muscoli, tra gli altri tessuti molli. A causa di ciò, lesioni e / o condizioni aggravate, come dischi erniciati, può eventualmente portare a sintomi di mal di schiena. Le lesioni sportive o gli incidenti automobilistici sono spesso la causa più frequente di mal di schiena, tuttavia a volte il più semplice dei movimenti può avere risultati dolorosi. Fortunatamente, le opzioni di trattamento alternative, come la cura chiropratica, possono aiutare ad alleviare il mal di schiena attraverso l'uso di aggiustamenti spinali e manipolazioni manuali, in definitiva migliorando il sollievo dal dolore.

foto di blog del fumetto carta ragazzo

EXTRA EXTRA | ARGOMENTO IMPORTANTE: consigliato El Paso, TX Chiropractor

***

Cos&#39;è il sulforafano?

Cos'è il sulforafano?

sulforafano è un phytochemical, una sostanza all'interno del gruppo di isotiocianato di composti organosulfur, trovato in verdure crocifere, come broccoli, cavoli, cavolfiori e cavolini di Bruxelles. Può anche essere trovato in bok choy, kale, cavoli, senape e crescione. Studi di ricerca hanno dimostrato che il sulforafano può aiutare a prevenire vari tipi di cancro entro il 2010 attivando la produzione di Nrf2o fattore eritropoietico fattore 2 correlato, un fattore di trascrizione che regola i meccanismi antiossidanti protettivi che controllano la risposta della cellula agli ossidanti. Lo scopo del seguente articolo è descrivere la funzione del sulforafano.

astratto

Il sistema antiossidante KEAP1-Nrf2-ARE è un mezzo principale con cui le cellule rispondono agli stress ossidativi e xenobiotici. Il sulforafano (SFN), un isotiocianato elettrofilo derivato da verdure crocifere, attiva la via KEAP1-Nrf2-ARE ed è diventato una molecola di interesse nel trattamento di malattie in cui lo stress ossidativo cronico svolge un ruolo etiologico importante. Dimostriamo qui che i mitocondri di cellule epiteliali della retina umana (RPE-1) in coltura trattate con SFN subiscono l'iperfusione che è indipendente sia da Nrf2 che dal suo inibitore citoplasmatico KEAP1. È stato riportato che la fusione mitocondriale è citoprotettiva inibendo la formazione dei pori nei mitocondri durante l'apoptosi e, coerentemente con questo, mostriamo la citoprotezione indipendente da Nrf2, delle cellule trattate con SFN esposte all'induatore-apoptosi, staurosporina. Meccanicamente, l'SFN attenua il reclutamento e / o la ritenzione del fattore di fissione solubile Drp1 nei mitocondri e nei perossisomi, ma non influenza l'abbondanza complessiva di Drp1. Questi dati dimostrano che le proprietà benefiche di SFN si estendono oltre l'attivazione del sistema KEAP1-Nrf2-ARE e garantiscono ulteriori interrogazioni dato l'uso corrente di questo agente in più studi clinici.

parole chiave: Sulforaphane, Nrf2, Drp1, Mitocondri, Fissione, Fusione, Apoptosi

Introduzione

Sulforaphane è un inibitore indipendente di Nrf2 della fissione mitocondriale

Il sulforafano (SFN) è un composto di isotiocianato derivato dalla dieta più comunemente dalle verdure crocifere [56]. È generato nelle piante come risposta xenobiotica alla predazione tramite rilascio vescicolare dell'enzima idrolitico mirosinasi dalle cellule danneggiate; questo enzima converte i glucosinolati in isotiocianati [42]. Negli ultimi due decenni, SFN è stato ampiamente caratterizzato per le sue proprietà antitumorali, antiossidanti e antimicrobiche segnalate [57]. Gran parte di questa efficacia è stata attribuita alla capacità di SFN di modulare la via di segnalazione dell'elemento di risposta antiossidante (ARE) di KEAP1-Nrf2, sebbene siano state identificate attività aggiuntive del composto, inclusa l'inibizione dell'attività dell'istone deacetilasi e la progressione del ciclo cellulare [ 29]. Nrf2 è il principale fattore di trascrizione antiossidante e in condizioni di omeostasi, la sua stabilità è soppressa attraverso l'azione del complesso citoplasmatico Cullin3KEAP1 ubiquitin ligasi [20]. Nello specifico, Nrf2 viene assunto nella ligasi Cullin3KEAP1 legandosi all'adattatore di substrato dimerico KEAP1 e successivamente modificato con catene polyUb che mirano al fattore di trascrizione per la degradazione mediata dal proteasoma. Questo ricambio costitutivo limita l'emivita di Nrf2 nelle celle non accentate a ~ 15 min [30], [33], [46], [55]. In risposta a numerosi tipi di stress, in particolare lo stress ossidativo, KEAP1, una proteina ricca di cisteina, agisce come un sensore redox e la modificazione ossidativa delle cisteine ​​critiche, in particolare C151, di KEAP1 dissocia Nrf2-KEAP1 da CUL3 prevenendo così la degradazione di Nrf2 [ 8], [20], [55]. In particolare, SFN, e possibilmente altri attivatori Nrf2, imitano lo stress ossidativo modificando C151 di KEAP1 ad esempio [21]. La stabilizzazione di Nrf2 consente la sua traslocazione nel nucleo in cui induce l'espressione di una batteria di geni antiossidanti di fase II e di disintossicazione. Nrf2 si lega agli elementi promotori della risposta antiossidante (ARE) dei suoi geni bersaglio affini attraverso l'eterodimerizzazione con piccole proteine ​​Maf [19]. Questo sistema presenta una risposta dinamica e sensibile agli antiossidanti indiretti come l'SFN, i radicali liberi generati dai mitocondri [16], o altre fonti fisiologiche di stress ossidativo [41].

I mitocondri sono organelli subcellulari dinamici che regolano una serie di funzioni cellulari che vanno dalla produzione di ATP e tampone del calcio intracellulare alla regolazione redox e all'apoptosi [13], [49]. I mitocondri rappresentano anche la principale fonte di specie reattive dell'ossigeno (ROS) all'interno della cellula. È quindi necessaria una corretta regolazione della funzione mitocondriale per ottimizzare la produzione di ATP per soddisfare le esigenze cellulari riducendo al contempo al contempo gli effetti potenzialmente dannosi dell'eccessiva produzione di radicali liberi. Un requisito critico per la modulazione fine della funzione mitocondriale è la capacità dei mitocondri di funzionare sia come macchine biochimiche sia come parte di una vasta rete reattiva.

La morfologia e la funzione della rete mitocondriale sono determinate da un equilibrio regolato tra fissione e fusione. La fissione mitocondriale è necessaria per l'ereditarietà cellulare dei mitocondri durante la divisione cellulare [28] e per la degradazione autofagica selettiva di mitocondri depolarizzati o danneggiati, denominati mitophagy [1]. Al contrario, è necessaria la fusione per la complementazione dei genomi mitocondriali e la condivisione delle componenti della catena di trasporto degli elettroni tra i mitocondri vicini [54]. A livello molecolare, la fissione mitocondriale e la fusione sono regolate da grandi GTPasi di tipo dynaminico. Tre enzimi regolano principalmente la fusione: Mitofusins ​​1 e 2 (Mfn1 / 2) sono proteine ​​di membrana esterna a due passaggi che mediano la fusione della membrana esterna tramite interazioni eterotipiche tra i mitocondri adiacenti [15], [25], [37], mentre OPA1 è un interno proteina di membrana che assicura simultaneamente la connettività della matrice regolando la fusione delle membrane interne [5]. L'attività GTPase di tutte e tre le proteine ​​è necessaria per la fusione robusta [5], [18] e OPA1 è ulteriormente regolato dalla proteolisi complessa all'interno della membrana mitocondriale da parte delle proteasi OMA1 [14], PARL [6] e YME1L [45 ]. È importante sottolineare che il potenziale di membrana mitocondriale intatto è necessario per una fusione efficiente al fine di sopprimere l'integrazione di mitocondri danneggiati e sani [26].

La fissione mitocondriale è principalmente catalizzata da una proteina citosolica chiamata proteina 1 correlata alla Dynamin (Drp1 / DNM1L). Drp1 è reclutato dal citosol a siti prospettici di fissione sulla membrana esterna mitocondriale [43]. I principali recettori per Drp1 sulla membrana esterna sono il fattore di fissione mitocondriale (Mff) [32] e, in misura minore, Fission 1 (Fis1) [51]. Inoltre, è stato scoperto un recettore dell'esca, MIEF1 / MiD51, che agisce per limitare ulteriormente l'attività della proteina Drp1 in potenziali siti di fissione [58]. Una volta ancorata alla membrana mitocondriale esterna, Drp1 si oligomerizza in strutture a spirale attorno al corpo del mitocondrio e quindi utilizza l'energia derivata dall'idrolisi GTP per mediare la scissione fisica delle membrane mitocondriali esterne e interne [17]. I tubuli derivati ​​dal reticolo endoplasmatico agiscono come un costrittore iniziale dei mitocondri prima dell'oligomerizzazione di Drp1, sottolineando la rivelazione che i mitocondri non ristretti sono più ampi della circonferenza permissiva di una spirale di Drp1 completata [12]. La dinamica dell'actina è anche importante per le interazioni ER-mitocondrio che precedono la fissione mitocondriale [24]. Oltre al suo ruolo nella fissione mitocondriale, Drp1 catalizza la fissione dei perossisomi [40].

Drp1 è molto simile alla ben definita proteina dynamin in quanto entrambe le proteine ​​contengono un dominio GTPase N-terminale, un dominio centrale che è critico per l'auto-oligomerizzazione e un dominio effector GTPase C-terminale [31]. Drp1 raggiunge la selettività per le membrane mitocondriali attraverso una combinazione di interazioni con le sue proteine ​​recettoriali Mff e Fis1 e anche attraverso la sua affinità per la cardiolipina fosfolipidica specifica dei mitocondri attraverso l'esclusivo dominio B-insert di Drp1 [2]. Drp1 esiste tipicamente come un omotetramero nel citoplasma e l'ordine superiore nei siti di fissione mitocondriale è mediato dal dominio centrale di Drp1 [3].

Dato il legame implicito tra la funzione mitocondriale e il percorso di KEAP1-Nrf2-ARE, abbiamo studiato gli effetti dell'attivazione di Nrf2 sulla struttura e la funzione mitocondriale. Dimostriamo qui che SFN induce l'iperfusione mitocondriale che, inaspettatamente, è indipendente da Nrf2 e KEAP1. Questo effetto di SFN avviene attraverso un'inibizione della funzione Drp1. Dimostriamo inoltre che SFN conferisce resistenza all'apoptosi che è Nrf2-indipendente e imita quello osservato nelle cellule impoverito di Drp1. Questi dati indicano collettivamente che oltre a stabilizzare e attivare Nrf2, SFN modula la dinamica mitocondriale e preserva il fitness e la sopravvivenza cellulare.

risultati

Sulforaphane induce Nrf2 / Iperfusione indipendente di KEAP1 dei mitocondri

Nel corso dello studio degli effetti dell'attivazione di Nrf2 sulla dinamica della rete mitocondriale, abbiamo scoperto che il trattamento di cellule epiteliali del pigmento retinico immortalate (RPE-1) con sulforafano (SFN), un potente attivatore della segnalazione Nrf2, ha indotto una fusione robusta di la rete mitocondriale rispetto alle cellule di controllo trattate con veicoli (Fig. 1A e B). La morfologia dei mitocondri in queste cellule assomigliava molto a quella dei mitocondri nelle cellule impoverite da siRNA di Drp1 endogeno, il principale fattore di fissione mitocondriale (Fig. 1A). Questo risultato ha sollevato l'intrigante idea che la fissione mitocondriale e lo stato di fusione rispondano direttamente ai livelli di Nrf2 nella cellula. Tuttavia, la stimolazione delle cellule con altri stabilizzanti Nrf2 e attivatori come l'inibitore del proteasoma MG132, il pro-ossidante tBHQ o il knockdown dell'inibitore Nrf2 KEAP1 non ha indotto la fusione mitocondriale (Fig. 1A e B). Stabilizzazione di Nrf2 da queste manipolazioni è stata confermata da western blotting per Nrf2 endogeno (Fig. 1C). Inoltre, l'espressione di Nrf2 era dispensabile per la fusione mitocondriale indotta da SFN, in quanto il knockdown di Nrf2 endogeno con siRNA non è riuscito a contrastare questo fenotipo (Fig. 1D-F). Poiché SFN stimola la via KEAP1-Nrf2-ARE modificando covalentemente i residui di cisteina di KEAP1 [21], abbiamo abbattuto KEAP1 per stabilire se l'iperfusione mitocondriale indotta da SFN è stimolata attraverso un percorso indipendente da KEAP1-dipendente, ma Nrf2. Tuttavia, l'esaurimento di KEAP1 fallì anche nell'abrogare la fusione mitocondriale indotta da SFN (Fig. 1G-I). In effetti, SFN ha invertito la morfologia pro-fissione indotta dall'esaurimento di KEAP1 (Fig. 1G, pannello b contro pannello d). Questi risultati indicano che il trattamento con SFN causa la fusione mitocondriale indipendente dalla via canonica di KEAP1-Nrf2-ARE e ci ha portato a interrogare se la SFN influisce direttamente sui componenti della fissione mitocondriale o sui macchinari di fusione.

Figura 1 SFN induce la fusione mitocondriale indipendente da Nrf2 / KEAP1. (A) Le cellule RPE-1 sono state transfettate con i siRNA indicati e 3 giorni dopo trattati con DMSO o con gli attivatori Nrf2 SFN (50 μM), MG132 (10 μM) o tBHQ (100 μM) per 4 h. I mitocondri (rossi) sono etichettati con un anticorpo anti-Tom20, mentre i nuclei (blu) sono controcolorati con DAPI. (B) Grafico che mostra la quantificazione del punteggio di morfologia mitocondriale da (A). > Le cellule 50 per condizione sono state valutate in modo cieco. (C) Macchie occidentali rappresentative da (A). (D) Le cellule RPE-1 sono state trasfettate con 10 nM siRNA e 3 giorni dopo trattati con SFN per 4 h prima di essere fissati e colorati come in (A). (E) Grafico che mostra la quantificazione del punteggio del fenotipo mitocondriale da (D). > Le cellule 100 per condizione sono state valutate in modo cieco. (F) Macchie occidentali rappresentative da (D). (G) Le cellule sono state trasfettate e trattate come in (D) con siCON o siKEAP1. (H) Le cellule da (G) sono state classificate come in (B) ed (E) sulla base della morfologia mitocondriale. (I) Macchie occidentali rappresentative da (G). I dati in (B), (E) e (H) sono stati compilati da esperimenti indipendenti di 3 ciascuno e la significatività statistica è stata determinata dal test t di Student a due code. Le barre di errore riflettono +/- SD (per l'interpretazione dei riferimenti al colore in questa legenda figura, il lettore è riferito alla versione web di questo articolo).

Sulforaphane danneggia l'associazione mitocondriale di Drp1

Sulla base del riscontro che il trattamento con SFN induce l'iperfusione mitocondriale, abbiamo ipotizzato che questo fenotipo fosse o una conseguenza dell'eccessiva attività di fusione o di un'inibizione dell'attività della fissione. Per discriminare tra queste due possibilità, abbiamo confrontato la morfologia dei perossisomi in presenza e assenza di SFN. I perossisomi sono simili ai mitocondri in quanto sono organelli dinamici la cui forma e lunghezza sono costantemente in flusso [44]. I perossisomi contengono sia Fis1 che Mff nella loro membrana esterna e, di conseguenza, sono bersagli per la fissione mediata da Drp1 [22], [23]. Tuttavia, i perossisomi non utilizzano il meccanismo di fusione della rete mitocondriale e, di conseguenza, non subiscono la fusione [39]. Piuttosto, la fissione perossisomale è contrastata dall'allungamento dei perossisomi esistenti attraverso l'aggiunta de novo di membrane e proteine ​​[44]. Poiché ai perossisomi manca Mfn1 / 2 e OPA1, abbiamo pensato che se SFN attivasse il meccanismo di fusione invece di inibire il meccanismo di fissione, la lunghezza del perossisoma non ne risentirebbe. Nelle cellule trattate con veicoli, i perossisomi vengono mantenuti come organuli brevi, rotondi e puntiformi (Fig. 2, pannelli b e d). Tuttavia, il trattamento con SFN ha aumentato la lunghezza del perossisoma di ~ 2-fold rispetto alle cellule di controllo (Fig. 2, pannelli f e h). Inoltre, molti dei perossisomi sono stati pizzicati vicino al centro, indicando un potenziale difetto di scissione (Fig. 2, pannello h, punte di freccia). Allo stesso modo, i perossisomi nelle cellule trasfettate con DrP1 siRNA erano anormalmente lunghi (Fig. 2, pannelli j e l), confermando che Drp1 è richiesto per la fissione perossisomale e suggerendo che il trattamento con SFN provoca fenotipi mitocondriali e perossisomali interrompendo il meccanismo di fissione.

La figura 2 SFN induce l'allungamento perossisomiale. (A) Le cellule RPE-1 sono state trasfettate con 10 nM del siRNA indicato e 3 giorni dopo trattati con DMSO o 50 μM SFN per 4 h. I perossisomi (verdi) sono stati etichettati con un anticorpo anti-PMP70, mitocondri con MitoTracker (rosso) e DNA controcolorati con DAPI. Insetti ingranditi di perossisomi sono mostrati a destra (pannelli d, h, e l) per facilitare la visualizzazione dei cambiamenti nella morfologia indotti dalla deplezione di SFN e Drp1. Le punte delle frecce evidenziano i punti di costrizione. (Per l'interpretazione dei riferimenti al colore in questa legenda figura, il lettore è riferito alla versione web di questo articolo).

Successivamente abbiamo determinato come SFN limita la funzione Drp1. Le possibilità includevano riduzioni nei livelli di espressione, reclutamento / ritenzione nei mitocondri, oligomerizzazione o attività enzimatica della GTPasi. Un deficit in uno di questi porterebbe a una riduzione della fissione mitocondriale e dell'iperfusione. Non abbiamo rilevato cambiamenti riproducibili nei livelli di proteina Drp1 dopo il trattamento con SFN (Fig. 1C e 3A), e quindi concluso che SFN non altera la stabilità o l'espressione di Drp1, coerentemente con Drp1 con un'emivita di> 10 h [50] e i nostri trattamenti SFN sono di durata più breve. Successivamente, abbiamo studiato se SFN influenzato il reclutamento o la conservazione di Drp1 ai mitocondri. Studi di frazionamento hanno dimostrato che l'SFN induceva una perdita di Drp1 dalla frazione mitocondriale (Fig. 3A, corsie 7-8 e Fig. 3B). Come riportato in precedenza [43], solo una frazione minore di Drp1 (~ 3%) è associata alla rete mitocondriale in un dato momento in condizioni di stato stazionario con la maggior parte dell'enzima che risiede nel citoplasma (Fig. 3A, corsie 5-8 ). Questi dati di frazionamento sono stati confermati utilizzando un'analisi di co-localizzazione che ha mostrato una riduzione del ~ 40% nei focolai Drp1 localizzati mitocondri, puntati dopo trattamento con SFN (Fig. 3C e D). Insieme, questi dati indicano che la fusione mitocondriale indotta da SFN è, almeno in parte, dovuta all'associazione attenuata di Drp1 con i mitocondri. I nostri dati non distinguono se SFN interferisce con il reclutamento mitocondriale rispetto alla ritenzione mitocondriale di Drp1, o entrambi, poiché l'analisi di Drp1 endogeno non era suscettibile di visualizzare la GTPase mediante microscopia a cellule vive.

La figura 3 SFN causa una perdita di Drp1 dai mitocondri. (A) Frazionamento subcellulare di cellule RPE-1 dopo 4 h di DMSO o SFN. I lisati di cellule intere (WCL), nucleari (Nuc), citosolici (Cyto) e frazioni mitocondriali (Mito) sono stati risolti mediante SDS-PAGE e trattati per western blotting con gli anticorpi indicati. La migrazione dei marcatori di peso molecolare è indicata a sinistra. (B) Grafici che mostrano la quantificazione densitometrica di Drp1 nelle frazioni indicate da (A). (C) Le cellule RPE-1 sono state transfettate con 10 nM siCON o siDrp1 e 3 giorni dopo trattati con DMSO o SFN per 4 h. Drp1 (verde) è stato visualizzato con un anticorpo anti-Drp1, mitocondri con MitoTracker (rosso) e nuclei con DAPI (blu). (D) Analisi di co-localizzazione automatica di Drp1 e segnale MitoTracker da (C). I dati in (B) e (D) sono stati compilati dagli esperimenti indipendenti 3 e 5, rispettivamente, e la significatività statistica è stata determinata dal test t di Student a due code. Le barre di errore si riflettono +/- SD e gli asterischi indicano la significatività statistica. (Per l'interpretazione dei riferimenti al colore in questa legenda figura, il lettore è riferito alla versione web di questo articolo).

Sulforaphane conferisce protezione contro l'apoptosi indotta da Staurosportina Indipendente da Nrf2

Il lavoro precedente ha dimostrato che la fissione mitocondriale è permissiva nella formazione dei pori nella membrana mitocondriale esterna generata da Bax / Bak durante l'apoptosi [11]. Drp1 ha dimostrato di essere reclutato selettivamente ai mitocondri durante l'apoptosi [11] e, coerentemente con questo, i mitocondri frammentati sono stati osservati all'inizio del processo [27]. Al contrario, si ritiene che l'inibizione della fissione mitocondriale inibisca l'apoptosi bloccando la formazione dei pori della membrana esterna che consentono il rilascio del citocromo c [53]. Di conseguenza, la stimolazione della fusione mitocondriale ritarda la progressione dell'apoptosi indotta da composti che includono staurosporina (STS) [14]. Per determinare se SFN protegge le cellule RPE-1 dall'apoptosi mediata da STS e in tal caso, indipendentemente dal fatto che questo richieda Nrf2, abbiamo stabilito un test per indurre facilmente la scissione poliposa della ribosio polimerasi (PARP), un substrato della caspasi-3 attivata e marker definitivo di apoptosi. Il trattamento delle cellule RPE-1 con 1 μM STS per 6 h ha causato solo una modesta scollatura di PARP, tuttavia questo è stato impedito dal co-trattamento con SFN (ad esempio, Fig. 4A, corsia 3 versus 4). Per aumentare la robustezza di questo test, abbiamo ulteriormente sensibilizzato le cellule all'apoptosi indotta da STS pre-trattandole con siRNA che bersagliava il fattore anti-apoptotico, Bcl-XL. Questo pretrattamento ha ridotto l'espressione di Bcl-XL e la scissione di PARP marcatamente promossa in funzione del tempo esposto a STS (Fig. 4B, confronta la corsia 2 con le corsie 4-10). È importante sottolineare che 2 h di pre-trattamento con SFN ha attenuato la scollatura di PARP in cellule esposte a STS (Fig. 4C, corsia 3 versus 4 e corsia 5 versus 6). Allo stesso modo, le cellule stabili impoverite di Nrf2 da CRISPR / Cas9 sono state protette in modo comparabile dalla tossicità STS dal pre-trattamento SFN (Fig. 4C, corsia 11 versus 12 e corsia 13 versus 14 e Fig. 4D). Questa protezione è stata osservata utilizzando sia la scollatura PARP (Fig. 4C e D) che la morfologia cellulare (Fig. 4E) come letture. L'efficacia della deplezione di Nrf2 da parte di CRISPR / Cas9 è stata confermata da western blotting (Fig. 4C, Nrf2 blot). Come previsto, le cellule depleting di Drp1, che producono anche un fenotipo di iperfusione (Fig. 1A), hanno anche bloccato la scissione di PARP in risposta a STS rispetto alle cellule di controllo incubate con SFN (Fig. 4F e G). Insieme, questi risultati sono coerenti con SFN che conferisce protezione contro l'apoptosi attraverso la sua capacità di limitare la funzione di Drp1, indipendentemente dalla stabilizzazione e attivazione di Nrf2.

Figura 4 Gli effetti citoprotettivi di SFN sono indipendenti dall'espressione Nrf2 (A) Le cellule RPE-1 sono state pretrattate con DMSO o 50 μM SFN per 2 h prima del trattamento con DMSO, 1 μM staurosporine (STS) o 50 μM etoposide per 6 h e sono stati processati per il western blot anti-PARP. (B) Le cellule RPE-1 sono state transfettate con 2.5 nM siCON, 1 nM siBcl-XL o 2.5 nM siBcl-XL e 3 giorni dopo sono state trattate con DMSO o 1 μM STS per 2, 4 o 6 h. Sono mostrate le macchie occidentali rappresentative e la migrazione dei marcatori di peso molecolare è indicata a sinistra. (C) CRISPR / Cas9 generato wild-type (Nrf2WT) e Nrf2 knockout (Nrf2KO) Le cellule RPE-1 sono state trasfettate con 1 nM siBcl-XL e 3 giorni dopo sono state pretrattate con DMSO o 50 μM SFN per 2 h. Successivamente, le cellule sono state trattate con 1 μM STS per 2, 4 o 6 h. Sono mostrate le macchie occidentali rappresentative con gli anticorpi indicati. (D) Quantificazione del PARP scisso come percentuale del PARP totale (scisso + non tagliato) dagli esperimenti indipendenti 3. È importante sottolineare che i livelli di PARP clivato erano paragonabili se le cellule esprimessero Nrf2 o meno, indicando che la protezione da SFS da STS è indipendente dal fattore di trascrizione. (E) 20X immagini a contrasto di fase scattate immediatamente prima del raccolto di lisati da (C). Barra della scala = 65 μm. (F) Macchie occidentali rappresentative che dimostrano che l'esaurimento di Drp1 conferisce una protezione quasi paragonabile alla STS come trattamento con SFN. Le cellule RPE-1 sono state transfettate con 1 nM siBcl-XL e inoltre trasfettate con 10 nM siCON o 10 nM siDrp1. 3 giorni dopo, le cellule siCON sono state pre-trattate con SFN come in (A) e (C) e poi esposte a STS per 4 h prima di essere raccolte e processate per western blotting con gli anticorpi indicati. (G) Come (D) per i dati presentati in (F) compilati da esperimenti indipendenti 3. Le barre di errore riflettono +/- SEM

Discussione

Abbiamo scoperto che SFN modula la dinamica di fissione / fusione mitocondriale indipendentemente dai suoi effetti sulla via KEAP1-Nrf2-ARE. Questo è intrigante a causa di un presunto legame tra disfunzione mitocondriale e produzione di ROS e la necessità di squelchare i radicali liberi derivati ​​dai mitocondri attraverso l'attivazione di Nrf2. Questo ulteriore impatto funzionale di SFN è di potenziale importanza dato il numero di studi clinici 30 attualmente in corso per testare SFN per il trattamento di una varietà di malattie tra cui il cancro alla prostata, la broncopneumopatia ostruttiva e l'anemia falciforme [7], [10], [ 47].

Poiché SFN è un isotiocianato [56] e attiva la segnalazione Nrf2 mediante acilazione diretta delle cisteine ​​KEAP1 critiche per sopprimere la degradazione Nrf2 [21], ne consegue che SFN esercita i suoi effetti pro-fusione modulando l'attività di un fattore di fissione o fusione tramite la modificazione della cisteina . I nostri dati sostengono fortemente che Drp1 è regolato negativamente da SFN, anche se resta da chiarire se GTPase sia un obiettivo diretto di acilazione. Nonostante questo divario di conoscenze, la funzione di Drp1 è chiaramente compromessa dall'SFN in quanto sia i mitocondri che i perossisomi diventano iperfusi in risposta al trattamento con SFN e questi organelli condividono Drp1 per i rispettivi eventi di scissione [38]. Inoltre, l'SFN riduce la quantità di Drp1 che si localizza e si accumula nei mitocondri (Fig. 3). Poiché i nostri esperimenti sono stati condotti con tutte le proteine ​​endogene, la nostra scoperta di Drp1 nei siti di fissione mitocondriale è in condizioni di stato stazionario e, di conseguenza, non possiamo distinguere tra un reclutamento e un difetto di ritenzione dell'enzima causato da SFN. Inoltre, non possiamo eliminare la possibilità che gli SFN acilino un recettore ai mitocondri (Fis1 o Mff) per bloccare il reclutamento di Drp1, sospettiamo che Drp1 sia stato modificato direttamente. Drp1 ha nove cisteine, otto delle quali risiedono nel dominio centrale richiesto per l'oligomerizzazione [3], e una delle quali risiede nel dominio GTPase Effector (GED) al C-terminale di Drp1. L'acilazione diretta di una qualsiasi di queste cisteine ​​potrebbe causare un difetto di attività in Drp1 e quindi essere alla base dell'effetto di SFN sulla dinamica mitocondriale. In particolare, il lavoro precedente suggerisce che i difetti nell'oligomerizzazione e l'attività catalitica possono abrogare la ritenzione di Drp1 nei mitocondri [52]. Cys644 nel dominio GED è un obiettivo particolarmente attraente basato su un lavoro precedente che mostra la mutazione di queste mutazioni di cisteina che alterano l'attività di Drp1 GTPase [4] e che questa particolare cisteina è modificata da elettrofili reattivi al tiolo [9]. La risoluzione di questa domanda in sospeso richiederà la convalida spettrometrica di massa. In sintesi, abbiamo identificato una nuova funzione citoprotettiva per il composto SFN clinicamente rilevante. Oltre ad attivare il principale fattore di trascrizione antiossidante Nrf2, SFN promuove la fusione mitocondriale e perossisomale e questo effetto è indipendente da Nrf2. Il meccanismo alla base di questo fenomeno comporta una riduzione della funzione della GTPasi Drp1, il mediatore primario della fissione mitocondriale e perossisomale. Una delle principali conseguenze della fusione mitocondriale mediata da SFN è che le cellule diventano resistenti agli effetti tossici dell'induttore di apoptosi staurosporina. Questa ulteriore azione citoprotettiva di SFN potrebbe essere di particolare utilità clinica nelle numerose malattie neurodegenerative per le quali l'età è il principale fattore di rischio (ad esempio, morbo di Parkinson, morbo di Alzheimer, degenerazione maculare legata all'età) poiché tali malattie sono state associate all'apoptosi e ridotto livelli e / o disregolazione di Nrf2 [35], [36], [48]. Insieme, questi dati dimostrano che le proprietà citoprotettive di SFN si estendono oltre l'attivazione del sistema KEAP1-Nrf2-ARE e giustificano ulteriori studi dato l'uso corrente di questo agente in più studi clinici.

Materiali e Metodi

Saggi di apoptosi

Le cellule sono state seminate e trasfettate con siRNA come indicato di seguito. Le cellule sono state pre-trattate con 50 μM sulforafano per 2 h per indurre la fusione mitocondriale e sono state quindi trattate con 1 μM staurosporine per indurre l'apoptosi. Al momento della raccolta, i terreni sono stati raccolti in provette singole e sottoposti a centrifugazione ad alta velocità per pellet di cellule apoptotiche. Questo pellet cellulare è stato combinato con cellule aderenti e solubilizzato in tampone Laemmli a concentrazione 2. I campioni sono stati sottoposti a western blot anti-PARP.

Generazione di costruzione CRISPR / Cas9

Per creare LentiCRISPR / eCas9 1.1, LentiCRISPR v2 (aggiunta #52961) è stato dapprima tagliato con Age1 e BamH1. Successivamente, SpCas9 da eSpCas9 1.1 (addgene #71814) è stato amplificato con PCR amplificato con Age1 e BamH1 utilizzando i seguenti primer (avanti AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, Reverse AAGCGCGGATCCCTTTTTCTTTTTTGCCTGGCCGG) e ligato nel vettore di taglio sopra. sequenze di sgRNA sono state determinate utilizzando Benchling.com. I parametri sono stati impostati per indirizzare la sequenza di codifica con il punteggio più alto sul bersaglio e il più basso fuori bersaglio. Le seguenti sequenze (sequenza target sottolineata, hs sgNFE2L2 # 1 senso CACCGCGACGGAAAGAGTATGAGC, antisenso AAACGCTCATACTCTTTCCGTCGC; hs sgNFE2L2 # 2 senso CACCGGTTTCTGACTGGATGTGCT, antisenso AAACAGCACATCCAGTCAGAAACC; hs sgNFE2L2 # 3 senso CACCGGAGTAGTTGGCAGATCCAC, antisenso AAACGTGGATCTGCCAACTACTCC) sono stati ricotto e ligati in BsmB1 tagliato LentiCRISPR / eCas9 1.1. Le cellule RPE-1 infettate con lentivirus sono state selezionate con puromicina e mantenute come una popolazione aggregata. Knockout è stato confermato da immunofluorescenza e western blotting.

Coltura cellulare e trasfezione

Cellule epiteliali del pigmento retinico umano trasformate con telomerasi (RPE-1) (ATCC) sono state coltivate in Modified Eagle Medium (DMEM) di Dulbecco contenente glucosio 1 g / L integrato con penicillina, streptomicina, cocktail di aminoacidi non essenziali 1X (Life Technologies), e 10% siero bovino fetale (Life Technologies). Per trasfusioni di siRNA, le cellule 30,000-35,000 / ml sono state seminate durante la notte. Le cellule hanno ricevuto 10 nM siRNA diluito in DMEM privo di siero e combinato con 0.3% Interferin transfection reacent (PolyPlus). Per la sensibilizzazione all'apoptosi, le cellule hanno ricevuto 1 nM Bcl-XL siRNA. Le cellule sono state raccolte 2-3 giorni dopo la trasfezione.

Prodotti chimici, anticorpi e siRNA Oligos

Anticorpi contro α-tubulina (Cell Signalling), β-tubulin (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (Cell Signaling), PMP70 (Abcam) e Tom20 (BD Biosciences ) sono stati utilizzati in 1: diluizioni 1000 per western blotting e per immunofluorescenza. L'anticorpo di coniglio anti-Nrf2 in-house è stato utilizzato su 1: 2000 per western blotting [34], [59]. Sulforaphane (Sigma) e staurosporine (Tocris) sono stati utilizzati rispettivamente con 50 μM e 1 μM. siRNAs contro Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (Cell Signaling) e Bcl-XL (Cell Signing) sono stati utilizzati su 10 nM se non diversamente specificato.

Immunofluorescenza e in Vivo Labeling

Le cellule seminate su coprioggetti in vetro 18 mm sono state trattate con veicolo o farmaco, fissate in 3.7% formaldeide e quindi permeabilizzate in 0.2% Triton X-100 / PBS su ghiaccio per 10 min. Anticorpi primari sono stati incubati in albumina di siero bovino 3% (BSA) in PBS durante la notte a 4 ° C. Dopo i lavaggi con PBS, le cellule sono state incubate per 1 h in anticorpi secondari coniugati per specie, Alexa488- o Alexa546-, diluiti 1: 1000) e 0.1 μg / mL DAPI (Sigma) in 3% BSA / PBS. I mitocondri sono stati visualizzati mediante immunofluorescenza anti-Tom20 o incubando cellule in 200 nM MitoTracker Red CMXRos (Molecular Probes, Inc.) in DMEM privo di siero per 30 min a 37 ° C prima della fissazione.

Microscopia e analisi delle immagini

Campioni di immunofluorescenza sono stati visualizzati su un microscopio confocale LSM710 (Carl Zeiss). Le micrografie sono state catturate con gli obiettivi a immersione in olio 63X o 100X e le immagini sono state regolate e migliorate utilizzando Adobe Photoshop CS6. L'analisi di co-localizzazione è stata eseguita utilizzando la funzione di co-localizzazione di Carl Zeiss LSM710 con le soglie impostate manualmente mentre erano cieche all'identità dei campioni. Le barre della scala, se non diversamente indicato, sono 10 μm. La morfologia mitocondriale è stata valutata con punteggio cieco. Se i mitocondri di una cellula sono stati mantenuti come puncta multiplo, rotondo e discriminante, la cellula è stata classificata come "fissione". Se i singoli mitocondri erano indistinguibili e l'intera rete mitocondriale appariva continua, la cellula veniva classificata come "fusione". Tutte le altre cellule, incluse quelle con mitocondri clustering, sono state classificate come "intermedie".

Frazionamenti subcellulari

Le cellule RPE-1 sono cresciute fino a confluire. Dopo un lavaggio con PBS, le cellule sono state sottoposte a centrifugazione a 600 × g per 10 min e risospese in tampone di isolamento 600 μL (210 mM Mannitol, 70 mM Sucrose, 5 mM MOPS, 1 mM EDTA pH 7.4 + 1 mM PMSF). La sospensione è stata lisata 30 volte in un omogeneizzatore Dounce. Una frazione dell'omogenato è stata conservata come un "lisato di cellule intere". Il resto è stato sottoposto a centrifugazione a 800 × g per 10 min a nuclei di pellet. I surnatanti sono stati sottoposti a centrifugazione a 1500 × g per 10 min per eliminare i nuclei rimanenti e le cellule prive di isolamento. Questo surnatante è stato sottoposto a centrifugazione a 15,000 × g per 15 min a mitocondri a pellet. Il surnatante è stato preservato come "frazione citosolica". Il pellet è stato lavato delicatamente con PBS e risospeso in tampone isolante. La concentrazione proteica di ciascuna frazione è stata misurata mediante dosaggio di acido bicinconinico (BCA) e quantità equivalenti di proteine ​​sono state risolte mediante SDS-PAGE.

Macchia occidentale

Le cellule sono state lavate in PBS e solubilizzate in tampone solubilizzante Laemmli concentrato 2 volte (100 mM Tris [pH 6.8], 2% SDS, 0.008% bromofenolo blu, 2% 2-mercaptoetanolo, 26.3% glicerolo e 0.001% Pirinina Y). I lisati sono stati bolliti per 5 min prima del caricamento su gel di poliacrilammide di sodio dodecil solfato (SDS). Le proteine ​​sono state trasferite alle membrane di nitrocellulosa e le membrane sono state bloccate per 1 h in 5% Milk / TBST. Gli anticorpi primari sono stati diluiti in 5% Milk / TBST e incubati con il blot per una notte a 4 ° C. Gli anticorpi secondari coniugati con perossidasi di rafano (HRP) sono stati diluiti in 5% Milk / TBST. Le macchie sono state processate con chemiluminescenza avanzata e le quantificazioni densitometriche sono state eseguite utilizzando il software ImageJ.

Dr Jimenez White Coat

Il sulforafano è una sostanza chimica della raccolta di isotiocianato di sostanze organosolfuro ottenute da verdure crocifere, tra cui broccoli, cavoli, cavolfiori, cavoli e cavoli, tra gli altri. Il sulforafano viene prodotto quando l'enzima mirosinasi trasforma la glucorafanina, un glucosinolato, nel sulforafano, noto anche come sulforaphane-glucosinolato. I germogli di broccoli e il cavolfiore hanno la più alta concentrazione di glucorafanina o il precursore del sulforafano. Studi di ricerca hanno dimostrato che il sulforafano migliora le capacità antiossidanti dell'organismo umano per prevenire vari problemi di salute. Dr. Alex Jimenez DC, CCST Insight

Sulforaphane e suoi effetti su cancro, mortalità, invecchiamento, cervello e comportamento, malattie cardiache e altro ancora

Gli isotiocianati sono alcuni dei composti vegetali più importanti che si possono ottenere nella dieta. In questo video faccio il caso più completo per loro che sia mai stato fatto. Soglia di attenzione breve? Passa al tuo argomento preferito facendo clic su uno dei seguenti punti temporali. Timeline completa di seguito.

Sezioni chiave:

  • 00: 01: 14 - Cancro e mortalità
  • 00: 19: 04 - Invecchiamento
  • 00: 26: 30 - Cervello e comportamento
  • 00: 38: 06 - Riassunto finale
  • 00: 40: 27 - Dose

Timeline completa:

  • 00: 00: 34 - Introduzione di sulforaphane, uno degli obiettivi principali del video.
  • 00: 01: 14 - Consumo di verdure crocifere e riduzione della mortalità per tutte le cause.
  • 00: 02: 12 - Rischio di cancro alla prostata.
  • 00: 02: 23 - Rischio di cancro alla vescica.
  • 00: 02: 34 - Carcinoma polmonare nei fumatori.
  • 00: 02: 48 - Rischio di cancro al seno.
  • 00: 03: 13 - Ipotetico: cosa succede se hai già un cancro? (Interventistica)
  • 00: 03: 35 - Meccanismo plausibile che guida i dati associativi sul cancro e sulla mortalità.
  • 00: 04: 38 - Sulforaphane e cancro.
  • 00: 05: 32 - Prova animale che mostra un forte effetto dell'estratto di germogli di broccolo sullo sviluppo del tumore della vescica nei ratti.
  • 00: 06: 06 - Effetto dell'integrazione diretta di sulforafano nei pazienti affetti da cancro alla prostata.
  • 00: 07: 09 - Bioaccumulo di metaboliti di isotiocianato nel tessuto mammario effettivo.
  • 00: 08: 32 - Inibizione delle cellule staminali del carcinoma mammario.
  • 00: 08: 53 - Lezione di storia: le brassiche sono state istituite come aventi proprietà sanitarie anche nell'antica Roma.
  • 00: 09: 16 - La capacità del Sulforaphane di potenziare l'escrezione di cancerogeno (benzene, acroleina).
  • 00: 09: 51 - NRF2 come interruttore genetico tramite elementi di risposta antiossidante.
  • 00: 10: 10 - Come l'attivazione di NRF2 migliora l'escrezione di cancerogeno tramite glutatione-S-coniugati.
  • 00: 10: 34 - I cavoletti di Bruxelles aumentano la glutatione-S-transferasi e riducono il danno al DNA.
  • 00: 11: 20 - La bevanda di germogli di broccoli aumenta l'escrezione di benzene di 61%.
  • 00: 13: 31 - L'omogenato di germogli di broccoli aumenta gli enzimi antiossidanti nelle vie aeree superiori.
  • 00: 15: 45 - Consumo di verdure crocifere e mortalità per malattie cardiache.
  • 00: 16: 55 - La polvere di germogli di broccoli migliora i lipidi nel sangue e il rischio complessivo di malattie cardiache nei diabetici di tipo 2.
  • 00: 19: 04 - Inizio della sezione di invecchiamento.
  • 00: 19: 21 - La dieta arricchita con sulforafano migliora la durata della vita dei coleotteri da 15 a 30% (in determinate condizioni).
  • 00: 20: 34 - L'importanza della bassa infiammazione per la longevità.
  • 00: 22: 05 - Le verdure crocifere e la polvere di germogli di broccoli sembrano ridurre un'ampia varietà di marcatori infiammatori negli esseri umani.
  • 00: 23: 40 - Ricapitolazione di metà video: cancro, sezioni di invecchiamento
  • 00: 24: 14 - Gli studi sui topi suggeriscono che il sulforafano potrebbe migliorare la funzione immunitaria adattativa in età avanzata.
  • 00: 25: 18 - Sulforaphane ha migliorato la crescita dei peli in un modello murino di calvizie. Immagine su 00: 26: 10.
  • 00: 26: 30 - Inizio della sezione cervello e comportamento.
  • 00: 27: 18 - Effetto dell'estratto di germogli di broccoli sull'autismo.
  • 00: 27: 48 - Effetto del glucorapanin sulla schizofrenia.
  • 00: 28: 17 - Inizio della discussione sulla depressione (meccanismo e studi plausibili).
  • 00: 31: 21 - Lo studio del mouse utilizzando 10 diversi modelli di depressione indotta da stress mostra sulforapano in modo simile efficace come fluoxetina (prozac).
  • 00: 32: 00 - Lo studio mostra che l'ingestione diretta di glucorafanina nei topi è altrettanto efficace nel prevenire la depressione dal modello di stress sociale di sconfitta.
  • 00: 33: 01 - Inizio della sezione di neurodegenerazione.
  • 00: 33: 30 - Sulforaphane e malattia di Alzheimer.
  • 00: 33: 44 - Sulforaphane e morbo di Parkinson.
  • 00: 33: 51 - Sulforaphane e la malattia di Hungtington.
  • 00: 34: 13 - Sulforaphane aumenta le proteine ​​da shock termico.
  • 00: 34: 43 - Inizio della sezione traumatica di lesioni cerebrali.
  • 00: 35: 01 - Sulforaphane iniettato immediatamente dopo TBI migliora la memoria (studio del mouse).
  • 00: 35: 55 - Sulforaphane e plasticità neuronale.
  • 00: 36: 32 - Sulforaphane migliora l'apprendimento nel modello di diabete di tipo II nei topi.
  • 00: 37: 19 - Distrofia muscolare sulforapano e duchenne.
  • 00: 37: 44 - Inibizione della miostatina nelle cellule muscolari satelliti (in vitro).
  • 00: 38: 06 - Ricapitolazione tardiva: mortalità e cancro, danno al DNA, stress ossidativo e infiammazione, escrezione di benzene, malattie cardiovascolari, diabete di tipo II, effetti sul cervello (depressione, autismo, schizofrenia, neurodegenerazione), via NRF2.
  • 00: 40: 27 - Pensieri sulla determinazione di una dose di germogli di broccoli o sulforafano.
  • 00: 41: 01 - Aneddoti su germinazione a casa.
  • 00: 43: 14 - Sulle temperature di cottura e sull'attività del sulforafano.
  • 00: 43: 45 - Conversione batterica intestinale del sulforafano da glucorafanina.
  • 00: 44: 24 - Gli integratori funzionano meglio se combinati con la mirosinasi attiva delle verdure.
  • 00: 44: 56 - Tecniche di cottura e verdure crucifere.
  • 00: 46: 06 - Isotiocianati come goitrogens.

Ringraziamenti

Sciencedirect.com/science/article/pii/S2213231716302750

Come viene prodotto il sulforafano?

Il riscaldamento diminuisce l'attività delle proteine ​​epitelio-magiche e aumenta la formazione di sulforafano nei broccoli

astratto

Il sulforafano, un isotiocianato di broccoli, è uno dei più potenti anticancerogeni derivati ​​dal cibo. Questo composto non è presente nella verdura intatta, ma è formato dal suo precursore glucosinolato, la glucorafanina, dall'azione della mirosinasi, un enzima tioglucosidasi, quando il tessuto dei broccoli viene schiacciato o masticato. Tuttavia, un numero di studi ha dimostrato che la resa di sulforaphane dalla glucorafanina è bassa e che un analogo nitrilico non bioattivo, sulforafano nitrile, è il prodotto primario di idrolisi quando il tessuto vegetale viene schiacciato a temperatura ambiente. Prove recenti suggeriscono che in Arabidopsis, la formazione di nitrile da glucosinolati è controllata da una proteina termosensibile, proteina epithiospecifier (ESP), un cofattore non catalitico di mirosinasi. I nostri obiettivi erano di esaminare gli effetti del riscaldamento di cimette di broccoli e germogli sulla formazione di sulforaphane e sulforapano nitrile, per determinare se i broccoli contengono attività ESP, quindi per correlare i cambiamenti dipendenti dal calore nell'attività ESP, contenuto di sulforafano e bioattività, come misurato per induzione del enzima disintossicante di fase II chinone reduttasi (QR) in coltura cellulare. Riscaldamento di broccolo fresco o germogli di broccoli a 60 ° C prima dell'omogeneizzazione contemporaneamente aumento della formazione di sulforafano e diminuzione della formazione di nitrato sulforafano. Una significativa perdita di attività di ESP è stata parallela alla diminuzione della formazione di nitrato sulforafano. Il riscaldamento a 70 ° C e oltre ha ridotto la formazione di entrambi i prodotti nei cimeli dei broccoli, ma non nei germogli di broccoli. L'induzione di QR in cellule di epatoma di topo coltivate Hepa lclc7 parallelamente aumenta la formazione di sulforafano.

I cimeli e i germogli di broccoli preriscaldanti a 60 ° C hanno aumentato in modo significativo la formazione catalizzata di sulforafano (SF) dalla mirosinasi in estratti di tessuto vegetale dopo la frantumazione. Questo è stato associato con diminuzioni nella formazione di nitrato di sulforaphane (SF nitrile) e attività di proteina epitelio-secretoria (ESP).

parole chiave: Broccoli, Brassica oleracea, Cruciferae, Cancer, Anticarcinogen, Sulforaphane, Sulforaphane nitrile, Proteina epithiospecifier, Quinone reduttasi

In conclusione, il sulforafano è un fitochimico trovato nei broccoli e in altre verdure crocifere. Una quantità incontrollata di ossidanti causati da fattori sia interni che esterni può causare uno stress ossidativo nel corpo umano che può portare a una varietà di problemi di salute. Sulforaphane può attivare la produzione di Nrf2, un fattore di trascrizione che aiuta a regolare i meccanismi antiossidanti protettivi che controllano la risposta della cellula agli ossidanti. Lo scopo delle nostre informazioni è limitato ai problemi di salute chiropratica e spinale. Per discutere l'argomento, non esitate a chiedere al Dr. Jimenez o contattaci a 915-850-0900 .

A cura di Dr. Alex Jimenez

Riferito da: Sciencedirect.com

Pulsante Green Call Now H .png

Discussione aggiuntiva sull'argomento: mal di schiena acuto

Mal di schiena è una delle più diffuse cause di disabilità e giorni persi al lavoro in tutto il mondo. Il dolore alla schiena è il secondo motivo più comune per le visite di un medico, superate solo dalle infezioni delle alte vie respiratorie. Circa il 80 percento della popolazione subirà un dolore alla schiena almeno una volta nella vita. La colonna vertebrale è una struttura complessa composta da ossa, articolazioni, legamenti e muscoli, tra gli altri tessuti molli. A causa di ciò, lesioni e / o condizioni aggravate, come dischi erniciati, può eventualmente portare a sintomi di mal di schiena. Le lesioni sportive o gli incidenti automobilistici sono spesso la causa più frequente di mal di schiena, tuttavia a volte il più semplice dei movimenti può avere risultati dolorosi. Fortunatamente, le opzioni di trattamento alternative, come la cura chiropratica, possono aiutare ad alleviare il mal di schiena attraverso l'uso di aggiustamenti spinali e manipolazioni manuali, in definitiva migliorando il sollievo dal dolore.

foto di blog del fumetto carta ragazzo

EXTRA EXTRA | ARGOMENTO IMPORTANTE: consigliato El Paso, TX Chiropractor

***