PRENOTA ONLINE 24/7

Smettila di soffrire!

  • Quick n' Easy Appuntamento online
  • Prenota un appuntamento 24 ore su 7, XNUMX giorni su XNUMX
  • Chiama ufficio: 915-850-0900.
Lunedi8: 30 AM - 7: 00 PM
Martedì8: 30 AM - 7: 00 PM
Mercoledì8: 30 AM - 7: 00 PM
Giovedi8: 30 AM - 7: 00 PM
Venerdì8: 30 AM - 7: 00 PM
Sabato8: 30 AM - 1: 00 PM
DomenicaChiuso

Dottor Cell Emergenze 915-540-8444

PRENOTA ONLINE 24/7

Medicina funzionale®

🔴 Avviso: Come parte del nostro Trattamento per lesioni acute pratica, ora offriamo Integratore di medicina funzionale Valutazioni e trattamenti * dentro il nostro ambito clinico per i disturbi degenerativi cronici.  Per saperne di più* Chiamaci oggi: 915-850-0900

Spiegazione della medicina funzionale
Share

sulforafano è un phytochemical, una sostanza all'interno del gruppo di isotiocianato di composti organosulfur, trovato in verdure crocifere, come broccoli, cavoli, cavolfiori e cavolini di Bruxelles. Può anche essere trovato in bok choy, kale, cavoli, senape e crescione. Studi di ricerca hanno dimostrato che il sulforafano può aiutare a prevenire vari tipi di cancro entro il 2010 attivando la produzione di Nrf2, o fattore correlato al fattore nucleare eritroide 2, un fattore di trascrizione che regola i meccanismi antiossidanti protettivi che controllano la risposta della cellula agli ossidanti. Lo scopo del seguente articolo è descrivere la funzione del sulforafano.

Astratto

Il sistema antiossidante KEAP1-Nrf2-ARE è un mezzo principale con cui le cellule rispondono agli stress ossidativi e xenobiotici. Il sulforafano (SFN), un isotiocianato elettrofilo derivato da verdure crocifere, attiva la via KEAP1-Nrf2-ARE ed è diventato una molecola di interesse nel trattamento di malattie in cui lo stress ossidativo cronico svolge un ruolo etiologico importante. Dimostriamo qui che i mitocondri di cellule epiteliali della retina umana (RPE-1) in coltura trattate con SFN subiscono l'iperfusione che è indipendente sia da Nrf2 che dal suo inibitore citoplasmatico KEAP1. È stato riportato che la fusione mitocondriale è citoprotettiva inibendo la formazione dei pori nei mitocondri durante l'apoptosi e, coerentemente con questo, mostriamo la citoprotezione indipendente da Nrf2, delle cellule trattate con SFN esposte all'induatore-apoptosi, staurosporina. Meccanicamente, l'SFN attenua il reclutamento e / o la ritenzione del fattore di fissione solubile Drp1 nei mitocondri e nei perossisomi, ma non influenza l'abbondanza complessiva di Drp1. Questi dati dimostrano che le proprietà benefiche di SFN si estendono oltre l'attivazione del sistema KEAP1-Nrf2-ARE e garantiscono ulteriori interrogazioni dato l'uso corrente di questo agente in più studi clinici.

parole chiave: Sulforaphane, Nrf2, Drp1, Mitocondri, Fissione, Fusione, Apoptosi

Introduzione

Sulforaphane è un inibitore indipendente di Nrf2 della fissione mitocondriale

Il sulforafano (SFN) è un composto di isotiocianato derivato dalla dieta più comunemente dalle verdure crocifere [56]. È generato nelle piante come risposta xenobiotica alla predazione tramite rilascio vescicolare dell'enzima idrolitico mirosinasi dalle cellule danneggiate; questo enzima converte i glucosinolati in isotiocianati [42]. Negli ultimi due decenni, SFN è stato ampiamente caratterizzato per le sue proprietà antitumorali, antiossidanti e antimicrobiche segnalate [57]. Gran parte di questa efficacia è stata attribuita alla capacità di SFN di modulare la via di segnalazione dell'elemento di risposta antiossidante (ARE) di KEAP1-Nrf2, sebbene siano state identificate attività aggiuntive del composto, inclusa l'inibizione dell'attività dell'istone deacetilasi e la progressione del ciclo cellulare [ 29]. Nrf2 è il principale fattore di trascrizione antiossidante e in condizioni di omeostasi, la sua stabilità è soppressa attraverso l'azione del complesso citoplasmatico Cullin3KEAP1 ubiquitin ligasi [20]. Nello specifico, Nrf2 viene assunto nella ligasi Cullin3KEAP1 legandosi all'adattatore di substrato dimerico KEAP1 e successivamente modificato con catene polyUb che mirano al fattore di trascrizione per la degradazione mediata dal proteasoma. Questo ricambio costitutivo limita l'emivita di Nrf2 nelle celle non accentate a ~ 15 min [30], [33], [46], [55]. In risposta a numerosi tipi di stress, in particolare lo stress ossidativo, KEAP1, una proteina ricca di cisteina, agisce come un sensore redox e la modificazione ossidativa delle cisteine ​​critiche, in particolare C151, di KEAP1 dissocia Nrf2-KEAP1 da CUL3 prevenendo così la degradazione di Nrf2 [ 8], [20], [55]. In particolare, SFN, e possibilmente altri attivatori Nrf2, imitano lo stress ossidativo modificando C151 di KEAP1 ad esempio [21]. La stabilizzazione di Nrf2 consente la sua traslocazione nel nucleo in cui induce l'espressione di una batteria di geni antiossidanti di fase II e di disintossicazione. Nrf2 si lega agli elementi promotori della risposta antiossidante (ARE) dei suoi geni bersaglio affini attraverso l'eterodimerizzazione con piccole proteine ​​Maf [19]. Questo sistema presenta una risposta dinamica e sensibile agli antiossidanti indiretti come l'SFN, i radicali liberi generati dai mitocondri [16], o altre fonti fisiologiche di stress ossidativo [41].

I mitocondri sono organelli subcellulari dinamici che regolano una serie di funzioni cellulari che vanno dalla produzione di ATP e tampone del calcio intracellulare alla regolazione redox e all'apoptosi [13], [49]. I mitocondri rappresentano anche la principale fonte di specie reattive dell'ossigeno (ROS) all'interno della cellula. È quindi necessaria una corretta regolazione della funzione mitocondriale per ottimizzare la produzione di ATP per soddisfare le esigenze cellulari riducendo al contempo al contempo gli effetti potenzialmente dannosi dell'eccessiva produzione di radicali liberi. Un requisito critico per la modulazione fine della funzione mitocondriale è la capacità dei mitocondri di funzionare sia come macchine biochimiche sia come parte di una vasta rete reattiva.

La morfologia e la funzione della rete mitocondriale sono determinate da un equilibrio regolato tra fissione e fusione. La fissione mitocondriale è necessaria per l'ereditarietà cellulare dei mitocondri durante la divisione cellulare [28] e per la degradazione autofagica selettiva di mitocondri depolarizzati o danneggiati, denominati mitophagy [1]. Al contrario, è necessaria la fusione per la complementazione dei genomi mitocondriali e la condivisione delle componenti della catena di trasporto degli elettroni tra i mitocondri vicini [54]. A livello molecolare, la fissione mitocondriale e la fusione sono regolate da grandi GTPasi di tipo dynaminico. Tre enzimi regolano principalmente la fusione: Mitofusins ​​1 e 2 (Mfn1 / 2) sono proteine ​​di membrana esterna a due passaggi che mediano la fusione della membrana esterna tramite interazioni eterotipiche tra i mitocondri adiacenti [15], [25], [37], mentre OPA1 è un interno proteina di membrana che assicura simultaneamente la connettività della matrice regolando la fusione delle membrane interne [5]. L'attività GTPase di tutte e tre le proteine ​​è necessaria per la fusione robusta [5], [18] e OPA1 è ulteriormente regolato dalla proteolisi complessa all'interno della membrana mitocondriale da parte delle proteasi OMA1 [14], PARL [6] e YME1L [45 ]. È importante sottolineare che il potenziale di membrana mitocondriale intatto è necessario per una fusione efficiente al fine di sopprimere l'integrazione di mitocondri danneggiati e sani [26].

La fissione mitocondriale è principalmente catalizzata da una proteina citosolica chiamata proteina 1 correlata alla Dynamin (Drp1 / DNM1L). Drp1 è reclutato dal citosol a siti prospettici di fissione sulla membrana esterna mitocondriale [43]. I principali recettori per Drp1 sulla membrana esterna sono il fattore di fissione mitocondriale (Mff) [32] e, in misura minore, Fission 1 (Fis1) [51]. Inoltre, è stato scoperto un recettore dell'esca, MIEF1 / MiD51, che agisce per limitare ulteriormente l'attività della proteina Drp1 in potenziali siti di fissione [58]. Una volta ancorata alla membrana mitocondriale esterna, Drp1 si oligomerizza in strutture a spirale attorno al corpo del mitocondrio e quindi utilizza l'energia derivata dall'idrolisi GTP per mediare la scissione fisica delle membrane mitocondriali esterne e interne [17]. I tubuli derivati ​​dal reticolo endoplasmatico agiscono come un costrittore iniziale dei mitocondri prima dell'oligomerizzazione di Drp1, sottolineando la rivelazione che i mitocondri non ristretti sono più ampi della circonferenza permissiva di una spirale di Drp1 completata [12]. La dinamica dell'actina è anche importante per le interazioni ER-mitocondrio che precedono la fissione mitocondriale [24]. Oltre al suo ruolo nella fissione mitocondriale, Drp1 catalizza la fissione dei perossisomi [40].

Drp1 è molto simile alla ben definita proteina dynamin in quanto entrambe le proteine ​​contengono un dominio GTPase N-terminale, un dominio centrale che è critico per l'auto-oligomerizzazione e un dominio effector GTPase C-terminale [31]. Drp1 raggiunge la selettività per le membrane mitocondriali attraverso una combinazione di interazioni con le sue proteine ​​recettoriali Mff e Fis1 e anche attraverso la sua affinità per la cardiolipina fosfolipidica specifica dei mitocondri attraverso l'esclusivo dominio B-insert di Drp1 [2]. Drp1 esiste tipicamente come un omotetramero nel citoplasma e l'ordine superiore nei siti di fissione mitocondriale è mediato dal dominio centrale di Drp1 [3].

Dato il legame implicito tra la funzione mitocondriale e il percorso di KEAP1-Nrf2-ARE, abbiamo studiato gli effetti dell'attivazione di Nrf2 sulla struttura e la funzione mitocondriale. Dimostriamo qui che SFN induce l'iperfusione mitocondriale che, inaspettatamente, è indipendente da Nrf2 e KEAP1. Questo effetto di SFN avviene attraverso un'inibizione della funzione Drp1. Dimostriamo inoltre che SFN conferisce resistenza all'apoptosi che è Nrf2-indipendente e imita quello osservato nelle cellule impoverito di Drp1. Questi dati indicano collettivamente che oltre a stabilizzare e attivare Nrf2, SFN modula la dinamica mitocondriale e preserva il fitness e la sopravvivenza cellulare.

risultati

Sulforaphane induce Nrf2 / Iperfusione indipendente di KEAP1 dei mitocondri

Nel corso dello studio degli effetti dell'attivazione di Nrf2 sulla dinamica della rete mitocondriale, abbiamo scoperto che il trattamento di cellule epiteliali del pigmento retinico immortalate (RPE-1) con sulforafano (SFN), un potente attivatore della segnalazione Nrf2, ha indotto una fusione robusta di la rete mitocondriale rispetto alle cellule di controllo trattate con veicoli (Fig. 1A e B). La morfologia dei mitocondri in queste cellule assomigliava molto a quella dei mitocondri nelle cellule impoverite da siRNA di Drp1 endogeno, il principale fattore di fissione mitocondriale (Fig. 1A). Questo risultato ha sollevato l'intrigante idea che la fissione mitocondriale e lo stato di fusione rispondano direttamente ai livelli di Nrf2 nella cellula. Tuttavia, la stimolazione delle cellule con altri stabilizzanti Nrf2 e attivatori come l'inibitore del proteasoma MG132, il pro-ossidante tBHQ o il knockdown dell'inibitore Nrf2 KEAP1 non ha indotto la fusione mitocondriale (Fig. 1A e B). Stabilizzazione di Nrf2 da queste manipolazioni è stata confermata da western blotting per Nrf2 endogeno (Fig. 1C). Inoltre, l'espressione di Nrf2 era dispensabile per la fusione mitocondriale indotta da SFN, in quanto il knockdown di Nrf2 endogeno con siRNA non è riuscito a contrastare questo fenotipo (Fig. 1D-F). Poiché SFN stimola la via KEAP1-Nrf2-ARE modificando covalentemente i residui di cisteina di KEAP1 [21], abbiamo abbattuto KEAP1 per stabilire se l'iperfusione mitocondriale indotta da SFN è stimolata attraverso un percorso indipendente da KEAP1-dipendente, ma Nrf2. Tuttavia, l'esaurimento di KEAP1 fallì anche nell'abrogare la fusione mitocondriale indotta da SFN (Fig. 1G-I). In effetti, SFN ha invertito la morfologia pro-fissione indotta dall'esaurimento di KEAP1 (Fig. 1G, pannello b contro pannello d). Questi risultati indicano che il trattamento con SFN causa la fusione mitocondriale indipendente dalla via canonica di KEAP1-Nrf2-ARE e ci ha portato a interrogare se la SFN influisce direttamente sui componenti della fissione mitocondriale o sui macchinari di fusione.

Figura 1 SFN induce la fusione mitocondriale indipendente da Nrf2 / KEAP1. (A) Le cellule RPE-1 sono state trasfettate con gli siRNA indicati e 3 giorni dopo sono state trattate con DMSO o gli attivatori Nrf2 SFN (50 μM), MG132 (10 μM) o tBHQ (100 μM) per 4 ore. I mitocondri (rossi) sono etichettati con un anticorpo anti-Tom20 e i nuclei (blu) sono controcolorati con DAPI. (B) Grafico che mostra la quantificazione del punteggio morfologico mitocondriale da (A). > 50 cellule per condizione sono state valutate in cieco. (C) Western blot rappresentativi da (A). (D) Le cellule RPE-1 sono state trasfettate con siRNA 10 nM e 3 giorni dopo sono state trattate con SFN per 4 ore prima di essere fissate e colorate come in (A). (E) Grafico che mostra la quantificazione del punteggio del fenotipo mitocondriale da (D). > 100 cellule per condizione sono state valutate in cieco. (F) Western blot rappresentativi da (D). (G) Le cellule sono state trasfettate e trattate come in (D) con siCON o siKEAP1. (H) Le cellule da (G) sono state valutate come in (B) ed (E) sulla base della morfologia mitocondriale. (I) Western blot rappresentativi da (G). I dati in (B), (E) e (H) sono stati compilati da 3 esperimenti indipendenti ciascuno e la significatività statistica è stata determinata dal test t di Student a due code. Le barre di errore riflettono +/- SD (per l'interpretazione dei riferimenti al colore nella legenda di questa figura, si rimanda il lettore alla versione web di questo articolo).

Sulforaphane danneggia l'associazione mitocondriale di Drp1

Sulla base del riscontro che il trattamento con SFN induce l'iperfusione mitocondriale, abbiamo ipotizzato che questo fenotipo fosse o una conseguenza dell'eccessiva attività di fusione o di un'inibizione dell'attività della fissione. Per discriminare tra queste due possibilità, abbiamo confrontato la morfologia dei perossisomi in presenza e assenza di SFN. I perossisomi sono simili ai mitocondri in quanto sono organelli dinamici la cui forma e lunghezza sono costantemente in flusso [44]. I perossisomi contengono sia Fis1 che Mff nella loro membrana esterna e, di conseguenza, sono bersagli per la fissione mediata da Drp1 [22], [23]. Tuttavia, i perossisomi non utilizzano il meccanismo di fusione della rete mitocondriale e, di conseguenza, non subiscono la fusione [39]. Piuttosto, la fissione perossisomale è contrastata dall'allungamento dei perossisomi esistenti attraverso l'aggiunta de novo di membrane e proteine ​​[44]. Poiché ai perossisomi manca Mfn1 / 2 e OPA1, abbiamo pensato che se SFN attivasse il meccanismo di fusione invece di inibire il meccanismo di fissione, la lunghezza del perossisoma non ne risentirebbe. Nelle cellule trattate con veicoli, i perossisomi vengono mantenuti come organuli brevi, rotondi e puntiformi (Fig. 2, pannelli b e d). Tuttavia, il trattamento con SFN ha aumentato la lunghezza del perossisoma di ~ 2-fold rispetto alle cellule di controllo (Fig. 2, pannelli f e h). Inoltre, molti dei perossisomi sono stati pizzicati vicino al centro, indicando un potenziale difetto di scissione (Fig. 2, pannello h, punte di freccia). Allo stesso modo, i perossisomi nelle cellule trasfettate con DrP1 siRNA erano anormalmente lunghi (Fig. 2, pannelli j e l), confermando che Drp1 è richiesto per la fissione perossisomale e suggerendo che il trattamento con SFN provoca fenotipi mitocondriali e perossisomali interrompendo il meccanismo di fissione.

La figura 2 SFN induce l'allungamento perossisomiale. (A) Le cellule RPE-1 sono state trasfettate con 10 nM del siRNA indicato e 3 giorni dopo trattati con DMSO o 50 μM SFN per 4 h. I perossisomi (verdi) sono stati etichettati con un anticorpo anti-PMP70, mitocondri con MitoTracker (rosso) e DNA controcolorati con DAPI. Insetti ingranditi di perossisomi sono mostrati a destra (pannelli d, h, e l) per facilitare la visualizzazione dei cambiamenti nella morfologia indotti dalla deplezione di SFN e Drp1. Le punte delle frecce evidenziano i punti di costrizione. (Per l'interpretazione dei riferimenti al colore in questa legenda figura, il lettore è riferito alla versione web di questo articolo).

Successivamente abbiamo determinato in che modo SFN limita la funzione Drp1. Le possibilità includevano riduzioni dei livelli di espressione, reclutamento / ritenzione ai mitocondri, oligomerizzazione o attività enzimatica della GTPasi. Un deficit in uno qualsiasi di questi comporterebbe una ridotta fissione e iperfusione mitocondriale. Non abbiamo rilevato cambiamenti riproducibili nei livelli di proteina Drp1 dopo il trattamento con SFN (Figure 1C e 3A), e quindi abbiamo concluso che SFN non altera la stabilità o l'espressione di Drp1, coerente con Drp1 che ha un'emivita> 10 h [50] ei nostri trattamenti SFN sono di durata inferiore. Successivamente, abbiamo studiato se SFN ha influenzato il reclutamento o la ritenzione di Drp1 nei mitocondri. Gli studi sul frazionamento hanno mostrato che SFN ha indotto una perdita di Drp1 dalla frazione mitocondriale (Fig. 3A, corsie 7–8 e Fig. 3B). Come riportato in precedenza [43], solo una frazione minore di Drp1 (~ 3%) è associata alla rete mitocondriale in un dato momento durante le condizioni di stato stazionario con la maggior parte dell'enzima residente nel citoplasma (Fig. 3A, corsie 5-8 ). Questi dati di frazionamento sono stati confermati utilizzando l'analisi di co-localizzazione che ha mostrato una riduzione di ~ 40% nei focolai Drp1 puntati e localizzati nei mitocondri dopo il trattamento con SFN (Fig. 3C e D). Insieme, questi dati indicano che la fusione mitocondriale indotta da SFN è, almeno in parte, dovuta all'associazione attenuata di Drp1 con i mitocondri. I nostri dati non distinguono tra se SFN interferisce con il reclutamento mitocondriale rispetto alla ritenzione mitocondriale di Drp1, o entrambi, poiché l'analisi di Drp1 endogena non era suscettibile di visualizzare la GTPasi mediante microscopia a cellule vive.

La figura 3 SFN causa una perdita di Drp1 dai mitocondri. (A) Frazionamento subcellulare di cellule RPE-1 dopo 4 h di DMSO o SFN. I lisati di cellule intere (WCL), nucleari (Nuc), citosolici (Cyto) e frazioni mitocondriali (Mito) sono stati risolti mediante SDS-PAGE e trattati per western blotting con gli anticorpi indicati. La migrazione dei marcatori di peso molecolare è indicata a sinistra. (B) Grafici che mostrano la quantificazione densitometrica di Drp1 nelle frazioni indicate da (A). (C) Le cellule RPE-1 sono state transfettate con 10 nM siCON o siDrp1 e 3 giorni dopo trattati con DMSO o SFN per 4 h. Drp1 (verde) è stato visualizzato con un anticorpo anti-Drp1, mitocondri con MitoTracker (rosso) e nuclei con DAPI (blu). (D) Analisi di co-localizzazione automatica di Drp1 e segnale MitoTracker da (C). I dati in (B) e (D) sono stati compilati dagli esperimenti indipendenti 3 e 5, rispettivamente, e la significatività statistica è stata determinata dal test t di Student a due code. Le barre di errore si riflettono +/- SD e gli asterischi indicano la significatività statistica. (Per l'interpretazione dei riferimenti al colore in questa legenda figura, il lettore è riferito alla versione web di questo articolo).

Sulforaphane conferisce protezione contro l'apoptosi indotta da Staurosportina Indipendente da Nrf2

Il lavoro precedente ha dimostrato che la fissione mitocondriale è permissiva nella formazione dei pori nella membrana mitocondriale esterna generata da Bax / Bak durante l'apoptosi [11]. Drp1 ha dimostrato di essere reclutato selettivamente ai mitocondri durante l'apoptosi [11] e, coerentemente con questo, i mitocondri frammentati sono stati osservati all'inizio del processo [27]. Al contrario, si ritiene che l'inibizione della fissione mitocondriale inibisca l'apoptosi bloccando la formazione dei pori della membrana esterna che consentono il rilascio del citocromo c [53]. Di conseguenza, la stimolazione della fusione mitocondriale ritarda la progressione dell'apoptosi indotta da composti che includono staurosporina (STS) [14]. Per determinare se SFN protegge le cellule RPE-1 dall'apoptosi mediata da STS e in tal caso, indipendentemente dal fatto che questo richieda Nrf2, abbiamo stabilito un test per indurre facilmente la scissione poliposa della ribosio polimerasi (PARP), un substrato della caspasi-3 attivata e marker definitivo di apoptosi. Il trattamento delle cellule RPE-1 con 1 μM STS per 6 h ha causato solo una modesta scollatura di PARP, tuttavia questo è stato impedito dal co-trattamento con SFN (ad esempio, Fig. 4A, corsia 3 versus 4). Per aumentare la robustezza di questo test, abbiamo ulteriormente sensibilizzato le cellule all'apoptosi indotta da STS pre-trattandole con siRNA che bersagliava il fattore anti-apoptotico, Bcl-XL. Questo pretrattamento ha ridotto l'espressione di Bcl-XL e la scissione di PARP marcatamente promossa in funzione del tempo esposto a STS (Fig. 4B, confronta la corsia 2 con le corsie 4-10). È importante sottolineare che 2 h di pre-trattamento con SFN ha attenuato la scollatura di PARP in cellule esposte a STS (Fig. 4C, corsia 3 versus 4 e corsia 5 versus 6). Allo stesso modo, le cellule stabili impoverite di Nrf2 da CRISPR / Cas9 sono state protette in modo comparabile dalla tossicità STS dal pre-trattamento SFN (Fig. 4C, corsia 11 versus 12 e corsia 13 versus 14 e Fig. 4D). Questa protezione è stata osservata utilizzando sia la scollatura PARP (Fig. 4C e D) che la morfologia cellulare (Fig. 4E) come letture. L'efficacia della deplezione di Nrf2 da parte di CRISPR / Cas9 è stata confermata da western blotting (Fig. 4C, Nrf2 blot). Come previsto, le cellule depleting di Drp1, che producono anche un fenotipo di iperfusione (Fig. 1A), hanno anche bloccato la scissione di PARP in risposta a STS rispetto alle cellule di controllo incubate con SFN (Fig. 4F e G). Insieme, questi risultati sono coerenti con SFN che conferisce protezione contro l'apoptosi attraverso la sua capacità di limitare la funzione di Drp1, indipendentemente dalla stabilizzazione e attivazione di Nrf2.

Figura 4 Gli effetti citoprotettivi di SFN sono indipendenti dall'espressione Nrf2 (A) Le cellule RPE-1 sono state pretrattate con DMSO o 50 μM SFN per 2 h prima del trattamento con DMSO, 1 μM staurosporine (STS) o 50 μM etoposide per 6 h e sono stati processati per il western blot anti-PARP. (B) Le cellule RPE-1 sono state transfettate con 2.5 nM siCON, 1 nM siBcl-XL o 2.5 nM siBcl-XL e 3 giorni dopo sono state trattate con DMSO o 1 μM STS per 2, 4 o 6 h. Sono mostrate le macchie occidentali rappresentative e la migrazione dei marcatori di peso molecolare è indicata a sinistra. (C) CRISPR / Cas9 generato wild-type (Nrf2WT) e Nrf2 knockout (Nrf2KO) Le cellule RPE-1 sono state trasfettate con 1 nM siBcl-XL e 3 giorni dopo sono state pretrattate con DMSO o 50 μM SFN per 2 h. Successivamente, le cellule sono state trattate con 1 μM STS per 2, 4 o 6 h. Sono mostrate le macchie occidentali rappresentative con gli anticorpi indicati. (D) Quantificazione del PARP scisso come percentuale del PARP totale (scisso + non tagliato) dagli esperimenti indipendenti 3. È importante sottolineare che i livelli di PARP clivato erano paragonabili se le cellule esprimessero Nrf2 o meno, indicando che la protezione da SFS da STS è indipendente dal fattore di trascrizione. (E) 20X immagini a contrasto di fase scattate immediatamente prima del raccolto di lisati da (C). Barra della scala = 65 μm. (F) Macchie occidentali rappresentative che dimostrano che l'esaurimento di Drp1 conferisce una protezione quasi paragonabile alla STS come trattamento con SFN. Le cellule RPE-1 sono state transfettate con 1 nM siBcl-XL e inoltre trasfettate con 10 nM siCON o 10 nM siDrp1. 3 giorni dopo, le cellule siCON sono state pre-trattate con SFN come in (A) e (C) e poi esposte a STS per 4 h prima di essere raccolte e processate per western blotting con gli anticorpi indicati. (G) Come (D) per i dati presentati in (F) compilati da esperimenti indipendenti 3. Le barre di errore riflettono +/- SEM

Discussione

Abbiamo scoperto che SFN modula la dinamica di fissione / fusione mitocondriale indipendentemente dai suoi effetti sulla via KEAP1-Nrf2-ARE. Questo è intrigante a causa di un presunto legame tra disfunzione mitocondriale e produzione di ROS e la necessità di squelchare i radicali liberi derivati ​​dai mitocondri attraverso l'attivazione di Nrf2. Questo ulteriore impatto funzionale di SFN è di potenziale importanza dato il numero di studi clinici 30 attualmente in corso per testare SFN per il trattamento di una varietà di malattie tra cui il cancro alla prostata, la broncopneumopatia ostruttiva e l'anemia falciforme [7], [10], [ 47].

Poiché SFN è un isotiocianato [56] e attiva la segnalazione Nrf2 mediante acilazione diretta delle cisteine ​​KEAP1 critiche per sopprimere la degradazione Nrf2 [21], ne consegue che SFN esercita i suoi effetti pro-fusione modulando l'attività di un fattore di fissione o fusione tramite la modificazione della cisteina . I nostri dati sostengono fortemente che Drp1 è regolato negativamente da SFN, anche se resta da chiarire se GTPase sia un obiettivo diretto di acilazione. Nonostante questo divario di conoscenze, la funzione di Drp1 è chiaramente compromessa dall'SFN in quanto sia i mitocondri che i perossisomi diventano iperfusi in risposta al trattamento con SFN e questi organelli condividono Drp1 per i rispettivi eventi di scissione [38]. Inoltre, l'SFN riduce la quantità di Drp1 che si localizza e si accumula nei mitocondri (Fig. 3). Poiché i nostri esperimenti sono stati condotti con tutte le proteine ​​endogene, la nostra scoperta di Drp1 nei siti di fissione mitocondriale è in condizioni di stato stazionario e, di conseguenza, non possiamo distinguere tra un reclutamento e un difetto di ritenzione dell'enzima causato da SFN. Inoltre, non possiamo eliminare la possibilità che gli SFN acilino un recettore ai mitocondri (Fis1 o Mff) per bloccare il reclutamento di Drp1, sospettiamo che Drp1 sia stato modificato direttamente. Drp1 ha nove cisteine, otto delle quali risiedono nel dominio centrale richiesto per l'oligomerizzazione [3], e una delle quali risiede nel dominio GTPase Effector (GED) al C-terminale di Drp1. L'acilazione diretta di una qualsiasi di queste cisteine ​​potrebbe causare un difetto di attività in Drp1 e quindi essere alla base dell'effetto di SFN sulla dinamica mitocondriale. In particolare, il lavoro precedente suggerisce che i difetti nell'oligomerizzazione e l'attività catalitica possono abrogare la ritenzione di Drp1 nei mitocondri [52]. Cys644 nel dominio GED è un obiettivo particolarmente attraente basato su un lavoro precedente che mostra la mutazione di queste mutazioni di cisteina che alterano l'attività di Drp1 GTPase [4] e che questa particolare cisteina è modificata da elettrofili reattivi al tiolo [9]. La risoluzione di questa domanda in sospeso richiederà la convalida spettrometrica di massa. In sintesi, abbiamo identificato una nuova funzione citoprotettiva per il composto SFN clinicamente rilevante. Oltre ad attivare il principale fattore di trascrizione antiossidante Nrf2, SFN promuove la fusione mitocondriale e perossisomale e questo effetto è indipendente da Nrf2. Il meccanismo alla base di questo fenomeno comporta una riduzione della funzione della GTPasi Drp1, il mediatore primario della fissione mitocondriale e perossisomale. Una delle principali conseguenze della fusione mitocondriale mediata da SFN è che le cellule diventano resistenti agli effetti tossici dell'induttore di apoptosi staurosporina. Questa ulteriore azione citoprotettiva di SFN potrebbe essere di particolare utilità clinica nelle numerose malattie neurodegenerative per le quali l'età è il principale fattore di rischio (ad esempio, morbo di Parkinson, morbo di Alzheimer, degenerazione maculare legata all'età) poiché tali malattie sono state associate all'apoptosi e ridotto livelli e / o disregolazione di Nrf2 [35], [36], [48].

Materiali e Metodi

Saggi di apoptosi

Le cellule sono state seminate e trasfettate con siRNA come indicato di seguito. Le cellule sono state pre-trattate con 50 μM sulforafano per 2 h per indurre la fusione mitocondriale e sono state quindi trattate con 1 μM staurosporine per indurre l'apoptosi. Al momento della raccolta, i terreni sono stati raccolti in provette singole e sottoposti a centrifugazione ad alta velocità per pellet di cellule apoptotiche. Questo pellet cellulare è stato combinato con cellule aderenti e solubilizzato in tampone Laemmli a concentrazione 2. I campioni sono stati sottoposti a western blot anti-PARP.

Generazione di costruzione CRISPR / Cas9

Per creare LentiCRISPR / eCas9 1.1, LentiCRISPR v2 (aggiunta #52961) è stato dapprima tagliato con Age1 e BamH1. Successivamente, SpCas9 da eSpCas9 1.1 (addgene #71814) è stato amplificato con PCR amplificato con Age1 e BamH1 utilizzando i seguenti primer (avanti AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, Reverse AAGCGCGGATCCCTTTTTCTTTTTTGCCTGGCCGG) e ligato nel vettore di taglio sopra. sequenze di sgRNA sono state determinate utilizzando Benchling.com. I parametri sono stati impostati per indirizzare la sequenza di codifica con il punteggio più alto sul bersaglio e il più basso fuori bersaglio. Le seguenti sequenze (sequenza target sottolineata, hs sgNFE2L2 # 1 senso CACCGCGACGGAAAGAGTATGAGC, antisenso AAACGCTCATACTCTTTCCGTCGC; hs sgNFE2L2 # 2 senso CACCGGTTTCTGACTGGATGTGCT, antisenso AAACAGCACATCCAGTCAGAAACC; hs sgNFE2L2 # 3 senso CACCGGAGTAGTTGGCAGATCCAC, antisenso AAACGTGGATCTGCCAACTACTCC) sono stati ricotto e ligati in BsmB1 tagliato LentiCRISPR / eCas9 1.1. Le cellule RPE-1 infettate con lentivirus sono state selezionate con puromicina e mantenute come una popolazione aggregata. Knockout è stato confermato da immunofluorescenza e western blotting.

Coltura cellulare e trasfezione

Cellule epiteliali del pigmento retinico umano trasformate con telomerasi (RPE-1) (ATCC) sono state coltivate in Modified Eagle Medium (DMEM) di Dulbecco contenente glucosio 1 g / L integrato con penicillina, streptomicina, cocktail di aminoacidi non essenziali 1X (Life Technologies), e 10% siero bovino fetale (Life Technologies). Per trasfusioni di siRNA, le cellule 30,000-35,000 / ml sono state seminate durante la notte. Le cellule hanno ricevuto 10 nM siRNA diluito in DMEM privo di siero e combinato con 0.3% Interferin transfection reacent (PolyPlus). Per la sensibilizzazione all'apoptosi, le cellule hanno ricevuto 1 nM Bcl-XL siRNA. Le cellule sono state raccolte 2-3 giorni dopo la trasfezione.

Prodotti chimici, anticorpi e siRNA Oligos

Anticorpi contro α-tubulina (Cell Signalling), β-tubulin (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (Cell Signaling), PMP70 (Abcam) e Tom20 (BD Biosciences ) sono stati utilizzati in 1: diluizioni 1000 per western blotting e per immunofluorescenza. L'anticorpo di coniglio anti-Nrf2 in-house è stato utilizzato su 1: 2000 per western blotting [34], [59]. Sulforaphane (Sigma) e staurosporine (Tocris) sono stati utilizzati rispettivamente con 50 μM e 1 μM. siRNAs contro Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (Cell Signaling) e Bcl-XL (Cell Signing) sono stati utilizzati su 10 nM se non diversamente specificato.

Immunofluorescenza e in Vivo Labeling

Le cellule seminate su coprioggetti in vetro 18 mm sono state trattate con veicolo o farmaco, fissate in 3.7% formaldeide e quindi permeabilizzate in 0.2% Triton X-100 / PBS su ghiaccio per 10 min. Anticorpi primari sono stati incubati in albumina di siero bovino 3% (BSA) in PBS durante la notte a 4 ° C. Dopo i lavaggi con PBS, le cellule sono state incubate per 1 h in anticorpi secondari coniugati per specie, Alexa488- o Alexa546-, diluiti 1: 1000) e 0.1 μg / mL DAPI (Sigma) in 3% BSA / PBS. I mitocondri sono stati visualizzati mediante immunofluorescenza anti-Tom20 o incubando cellule in 200 nM MitoTracker Red CMXRos (Molecular Probes, Inc.) in DMEM privo di siero per 30 min a 37 ° C prima della fissazione.

Microscopia e analisi delle immagini

Campioni di immunofluorescenza sono stati visualizzati su un microscopio confocale LSM710 (Carl Zeiss). Le micrografie sono state catturate con gli obiettivi a immersione in olio 63X o 100X e le immagini sono state regolate e migliorate utilizzando Adobe Photoshop CS6. L'analisi di co-localizzazione è stata eseguita utilizzando la funzione di co-localizzazione di Carl Zeiss LSM710 con le soglie impostate manualmente mentre erano cieche all'identità dei campioni. Le barre della scala, se non diversamente indicato, sono 10 μm. La morfologia mitocondriale è stata valutata con punteggio cieco. Se i mitocondri di una cellula sono stati mantenuti come puncta multiplo, rotondo e discriminante, la cellula è stata classificata come "fissione". Se i singoli mitocondri erano indistinguibili e l'intera rete mitocondriale appariva continua, la cellula veniva classificata come "fusione". Tutte le altre cellule, incluse quelle con mitocondri clustering, sono state classificate come "intermedie".

Frazionamenti subcellulari

Le cellule RPE-1 sono cresciute fino a confluire. Dopo un lavaggio con PBS, le cellule sono state sottoposte a centrifugazione a 600 × g per 10 min e risospese in tampone di isolamento 600 μL (210 mM Mannitol, 70 mM Sucrose, 5 mM MOPS, 1 mM EDTA pH 7.4 + 1 mM PMSF). La sospensione è stata lisata 30 volte in un omogeneizzatore Dounce. Una frazione dell'omogenato è stata conservata come un "lisato di cellule intere". Il resto è stato sottoposto a centrifugazione a 800 × g per 10 min a nuclei di pellet. I surnatanti sono stati sottoposti a centrifugazione a 1500 × g per 10 min per eliminare i nuclei rimanenti e le cellule prive di isolamento. Questo surnatante è stato sottoposto a centrifugazione a 15,000 × g per 15 min a mitocondri a pellet. Il surnatante è stato preservato come "frazione citosolica". Il pellet è stato lavato delicatamente con PBS e risospeso in tampone isolante. La concentrazione proteica di ciascuna frazione è stata misurata mediante dosaggio di acido bicinconinico (BCA) e quantità equivalenti di proteine ​​sono state risolte mediante SDS-PAGE.

Macchia occidentale

Le cellule sono state lavate in PBS e solubilizzate in tampone solubilizzante Laemmli concentrato 2 volte (100 mM Tris [pH 6.8], 2% SDS, 0.008% bromofenolo blu, 2% 2-mercaptoetanolo, 26.3% glicerolo e 0.001% Pirinina Y). I lisati sono stati bolliti per 5 min prima del caricamento su gel di poliacrilammide di sodio dodecil solfato (SDS). Le proteine ​​sono state trasferite alle membrane di nitrocellulosa e le membrane sono state bloccate per 1 h in 5% Milk / TBST. Gli anticorpi primari sono stati diluiti in 5% Milk / TBST e incubati con il blot per una notte a 4 ° C. Gli anticorpi secondari coniugati con perossidasi di rafano (HRP) sono stati diluiti in 5% Milk / TBST. Le macchie sono state processate con chemiluminescenza avanzata e le quantificazioni densitometriche sono state eseguite utilizzando il software ImageJ.

Il sulforafano è una sostanza chimica della raccolta di isotiocianato di sostanze organosolfuro ottenute da verdure crocifere, tra cui broccoli, cavoli, cavolfiori, cavoli e cavoli, tra gli altri. Il sulforafano viene prodotto quando l'enzima mirosinasi trasforma la glucorafanina, un glucosinolato, nel sulforafano, noto anche come sulforaphane-glucosinolato. I germogli di broccoli e il cavolfiore hanno la più alta concentrazione di glucorafanina o il precursore del sulforafano. Studi di ricerca hanno dimostrato che il sulforafano migliora le capacità antiossidanti dell'organismo umano per prevenire vari problemi di salute. Dr. Alex Jimenez DC, CCST Insight

Sulforafano e suoi effetti su cancro, mortalità, invecchiamento, cervello e comportamento, malattie cardiache e altro

Gli isotiocianati sono alcuni dei composti vegetali più importanti che si possono ottenere nella dieta. In questo video faccio il caso più completo per loro che sia mai stato fatto. Soglia di attenzione breve? Passa al tuo argomento preferito facendo clic su uno dei seguenti punti temporali. Timeline completa di seguito.

Sezioni chiave:

  • 00: 01: 14 - Cancro e mortalità
  • 00: 19: 04 - Invecchiamento
  • 00: 26: 30 - Cervello e comportamento
  • 00: 38: 06 - Riassunto finale
  • 00: 40: 27 - Dose

Timeline completa:

  • 00: 00: 34 - Introduzione di sulforaphane, uno degli obiettivi principali del video.
  • 00: 01: 14 - Consumo di verdure crocifere e riduzione della mortalità per tutte le cause.
  • 00: 02: 12 - Rischio di cancro alla prostata.
  • 00: 02: 23 - Rischio di cancro alla vescica.
  • 00: 02: 34 - Carcinoma polmonare nei fumatori.
  • 00: 02: 48 - Rischio di cancro al seno.
  • 00: 03: 13 - Ipotetico: cosa succede se hai già un cancro? (Interventistica)
  • 00: 03: 35 - Meccanismo plausibile che guida i dati associativi sul cancro e sulla mortalità.
  • 00: 04: 38 - Sulforaphane e cancro.
  • 00: 05: 32 - Prova animale che mostra un forte effetto dell'estratto di germogli di broccolo sullo sviluppo del tumore della vescica nei ratti.
  • 00: 06: 06 - Effetto dell'integrazione diretta di sulforafano nei pazienti affetti da cancro alla prostata.
  • 00: 07: 09 - Bioaccumulo di metaboliti di isotiocianato nel tessuto mammario effettivo.
  • 00: 08: 32 - Inibizione delle cellule staminali del carcinoma mammario.
  • 00: 08: 53 - Lezione di storia: le brassiche sono state istituite come aventi proprietà sanitarie anche nell'antica Roma.
  • 00: 09: 16 - La capacità del Sulforaphane di potenziare l'escrezione di cancerogeno (benzene, acroleina).
  • 00: 09: 51 - NRF2 come interruttore genetico tramite elementi di risposta antiossidante.
  • 00: 10: 10 - Come l'attivazione di NRF2 migliora l'escrezione di cancerogeno tramite glutatione-S-coniugati.
  • 00: 10: 34 - I cavoletti di Bruxelles aumentano la glutatione-S-transferasi e riducono il danno al DNA.
  • 00: 11: 20 - La bevanda di germogli di broccoli aumenta l'escrezione di benzene di 61%.
  • 00: 13: 31 - L'omogenato di germogli di broccoli aumenta gli enzimi antiossidanti nelle vie aeree superiori.
  • 00: 15: 45 - Consumo di verdure crocifere e mortalità per malattie cardiache.
  • 00: 16: 55 - La polvere di germogli di broccoli migliora i lipidi nel sangue e il rischio complessivo di malattie cardiache nei diabetici di tipo 2.
  • 00: 19: 04 - Inizio della sezione di invecchiamento.
  • 00: 19: 21 - La dieta arricchita con sulforafano migliora la durata della vita dei coleotteri da 15 a 30% (in determinate condizioni).
  • 00: 20: 34 - L'importanza della bassa infiammazione per la longevità.
  • 00: 22: 05 - Le verdure crocifere e la polvere di germogli di broccoli sembrano ridurre un'ampia varietà di marcatori infiammatori negli esseri umani.
  • 00: 23: 40 - Ricapitolazione di metà video: cancro, sezioni di invecchiamento
  • 00: 24: 14 - Gli studi sui topi suggeriscono che il sulforafano potrebbe migliorare la funzione immunitaria adattativa in età avanzata.
  • 00: 25: 18 - Sulforaphane ha migliorato la crescita dei peli in un modello murino di calvizie. Immagine su 00: 26: 10.
  • 00: 26: 30 - Inizio della sezione cervello e comportamento.
  • 00: 27: 18 - Effetto dell'estratto di germogli di broccoli sull'autismo.
  • 00: 27: 48 - Effetto del glucorapanin sulla schizofrenia.
  • 00: 28: 17 - Inizio della discussione sulla depressione (meccanismo e studi plausibili).
  • 00: 31: 21 - Lo studio del mouse utilizzando 10 diversi modelli di depressione indotta da stress mostra sulforapano in modo simile efficace come fluoxetina (prozac).
  • 00: 32: 00 - Lo studio mostra che l'ingestione diretta di glucorafanina nei topi è altrettanto efficace nel prevenire la depressione dal modello di stress sociale di sconfitta.
  • 00: 33: 01 - Inizio della sezione di neurodegenerazione.
  • 00: 33: 30 - Sulforaphane e malattia di Alzheimer.
  • 00: 33: 44 - Sulforaphane e morbo di Parkinson.
  • 00: 33: 51 - Sulforaphane e la malattia di Hungtington.
  • 00: 34: 13 - Sulforaphane aumenta le proteine ​​da shock termico.
  • 00: 34: 43 - Inizio della sezione traumatica di lesioni cerebrali.
  • 00: 35: 01 - Sulforaphane iniettato immediatamente dopo TBI migliora la memoria (studio del mouse).
  • 00: 35: 55 - Sulforaphane e plasticità neuronale.
  • 00: 36: 32 - Sulforaphane migliora l'apprendimento nel modello di diabete di tipo II nei topi.
  • 00: 37: 19 - Distrofia muscolare sulforapano e duchenne.
  • 00: 37: 44 - Inibizione della miostatina nelle cellule muscolari satelliti (in vitro).
  • 00: 38: 06 - Ricapitolazione tardiva: mortalità e cancro, danno al DNA, stress ossidativo e infiammazione, escrezione di benzene, malattie cardiovascolari, diabete di tipo II, effetti sul cervello (depressione, autismo, schizofrenia, neurodegenerazione), via NRF2.
  • 00: 40: 27 - Pensieri sulla determinazione di una dose di germogli di broccoli o sulforafano.
  • 00: 41: 01 - Aneddoti su germinazione a casa.
  • 00: 43: 14 - Sulle temperature di cottura e sull'attività del sulforafano.
  • 00: 43: 45 - Conversione batterica intestinale del sulforafano da glucorafanina.
  • 00: 44: 24 - Gli integratori funzionano meglio se combinati con la mirosinasi attiva delle verdure.
  • 00: 44: 56 - Tecniche di cottura e verdure crucifere.
  • 00: 46: 06 - Isotiocianati come goitrogens.

Ringraziamenti

Sciencedirect.com/science/article/pii/S2213231716302750

Come viene prodotto il sulforafano?

Il riscaldamento diminuisce l'attività delle proteine ​​epitelio-magiche e aumenta la formazione di sulforafano nei broccoli

Astratto

Il sulforafano, un isotiocianato di broccoli, è uno dei più potenti anticancerogeni derivati ​​dal cibo. Questo composto non è presente nella verdura intatta, ma è formato dal suo precursore glucosinolato, la glucorafanina, dall'azione della mirosinasi, un enzima tioglucosidasi, quando il tessuto dei broccoli viene schiacciato o masticato. Tuttavia, un numero di studi ha dimostrato che la resa di sulforaphane dalla glucorafanina è bassa e che un analogo nitrilico non bioattivo, sulforafano nitrile, è il prodotto primario di idrolisi quando il tessuto vegetale viene schiacciato a temperatura ambiente. Prove recenti suggeriscono che in Arabidopsis, la formazione di nitrile da glucosinolati è controllata da una proteina termosensibile, proteina epithiospecifier (ESP), un cofattore non catalitico di mirosinasi. I nostri obiettivi erano di esaminare gli effetti del riscaldamento di cimette di broccoli e germogli sulla formazione di sulforaphane e sulforapano nitrile, per determinare se i broccoli contengono attività ESP, quindi per correlare i cambiamenti dipendenti dal calore nell'attività ESP, contenuto di sulforafano e bioattività, come misurato per induzione del enzima disintossicante di fase II chinone reduttasi (QR) in coltura cellulare. Riscaldamento di broccolo fresco o germogli di broccoli a 60 ° C prima dell'omogeneizzazione contemporaneamente aumento della formazione di sulforafano e diminuzione della formazione di nitrato sulforafano. Una significativa perdita di attività di ESP è stata parallela alla diminuzione della formazione di nitrato sulforafano. Il riscaldamento a 70 ° C e oltre ha ridotto la formazione di entrambi i prodotti nei cimeli dei broccoli, ma non nei germogli di broccoli. L'induzione di QR in cellule di epatoma di topo coltivate Hepa lclc7 parallelamente aumenta la formazione di sulforafano.

I cimeli e i germogli di broccoli preriscaldanti a 60 ° C hanno aumentato in modo significativo la formazione catalizzata di sulforafano (SF) dalla mirosinasi in estratti di tessuto vegetale dopo la frantumazione. Questo è stato associato con diminuzioni nella formazione di nitrato di sulforaphane (SF nitrile) e attività di proteina epitelio-secretoria (ESP).

parole chiave: Broccoli, Brassica oleracea, Cruciferae, Cancer, Anticarcinogen, Sulforaphane, Sulforaphane nitrile, Proteina epithiospecifier, Quinone reduttasi

In conclusione, il sulforafano è un fitochimico presente nei broccoli e in altre verdure crocifere. Una quantità incontrollata di ossidanti causata da fattori sia interni che esterni può causare stress ossidativo nel corpo umano che alla fine può portare a una varietà di problemi di salute. Il sulforafano può attivare la produzione di Nrf2, un fattore di trascrizione che aiuta a regolare i meccanismi antiossidanti protettivi che controllano la risposta delle cellule agli ossidanti. Lo scopo delle nostre informazioni è limitato ai problemi di salute della colonna vertebrale e della chiropratica. Per discutere l'argomento, non esitate a chiedere al Dr. Jimenez o contattarci a 915-850-0900 .

A cura di Dr. Alex Jimenez

Riferito da: Sciencedirect.com

Discussione aggiuntiva sull'argomento: dolore alla schiena acuto

Mal di schiena è una delle più diffuse cause di disabilità e giorni persi al lavoro in tutto il mondo. Il dolore alla schiena è il secondo motivo più comune per le visite di un medico, superate solo dalle infezioni delle alte vie respiratorie. Circa il 80 percento della popolazione subirà un dolore alla schiena almeno una volta nella vita. La colonna vertebrale è una struttura complessa composta da ossa, articolazioni, legamenti e muscoli, tra gli altri tessuti molli. A causa di ciò, lesioni e / o condizioni aggravate, come dischi erniciati, può eventualmente portare a sintomi di mal di schiena. Le lesioni sportive o gli incidenti automobilistici sono spesso la causa più frequente di mal di schiena, tuttavia a volte il più semplice dei movimenti può avere risultati dolorosi. Fortunatamente, le opzioni di trattamento alternative, come la cura chiropratica, possono aiutare ad alleviare il mal di schiena attraverso l'uso di aggiustamenti spinali e manipolazioni manuali, in definitiva migliorando il sollievo dal dolore.

EXTRA EXTRA | ARGOMENTO IMPORTANTE: consigliato El Paso, TX Chiropractor

***

Dr. Alex Jimenez DC, CCST

Benvenuto-Bienvenido's nel nostro blog. Ci concentriamo sul trattamento di gravi disabilità e lesioni spinali. Trattiamo anche sciatica, dolore al collo e alla schiena, colpo di frusta, mal di testa, lesioni al ginocchio, lesioni sportive, vertigini, cattivo sonno, artrite. Utilizziamo terapie avanzate e comprovate incentrate su mobilità, salute, fitness e condizionamento strutturale ottimali. Usiamo piani dietetici personalizzati, tecniche chiropratiche specializzate, allenamento mobilità-agilità, protocolli adattati cross-fit e il "sistema PUSH" per trattare i pazienti che soffrono di varie lesioni e problemi di salute. Se desideri saperne di più su un dottore in chiropratica che utilizza tecniche progressive avanzate per facilitare la salute fisica completa, ti preghiamo di connetterti con me. Ci concentriamo sulla semplicità per aiutare a ripristinare la mobilità e il recupero. Mi piacerebbe vederti Collegare!

Post Recenti

Prevenzione dell'inclinazione pelvica anteriore / posteriore con plantari chiropratici

Poche persone si rendono conto di avere problemi ai piedi. I piedi piatti possono causare anteriore o ... Leggi di più

Osteonecrosi della testa femorale diagnosticata erroneamente come sciatica

L'osteonecrosi è una condizione che causa la morte del tessuto osseo temporaneo o permanente ... Leggi di più

Disturbo degenerativo del disco dei giovani adulti e salute ottimale della colonna vertebrale

I giovani adulti non pensano al deterioramento / degenerazione del disco fino a quando non è il momento degli anni d'oro. Il… Leggi di più

Tecniche di manipolazione spinale chiropratica

Esiste una moltitudine di tecniche chiropratiche per l'allineamento della colonna vertebrale. Sono usati dai chiropratici ... Leggi di più

La danza del ventre può aiutare ad alleviare il mal di schiena

Si è scoperto che la danza del ventre è un modo efficace per aiutare le persone a gestire i bassi ... Leggi di più

L'articolazione lombosacrale e possibile causa del dolore al nervo sciatico

L'articolazione lombosacrale è il primo posto in cui i chiropratici iniziano la loro indagine con persone che si presentano con ... Leggi di più

Cronologia e registrazione in linea 🔘
Chiamaci oggi 🔘